Miyakogusa Predicted Gene
- Lj2g3v1968370.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v1968370.1 tr|C6TL96|C6TL96_SOYBN Adenylyl-sulfate kinase
OS=Glycine max GN=Gma.40304 PE=2
SV=1,76.13,0,APS_kinase,Adenylylsulphate kinase; apsK: adenylylsulfate
kinase,Adenylylsulphate kinase; ADENYLSULF,CUFF.38120.1
(948 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP068063 similar to UniRef100_O49204 Cluster: Adenylyl-... 454 e-127
gnl|LJGI|TC57721 similar to UniRef100_A7PLQ7 Cluster: Adenylyl-s... 446 e-124
gnl|LJGI|FS320128 similar to UniRef100_A2ZG75 Cluster: Adenylyl-... 266 2e-70
gnl|LJGI|TC57974 similar to UniRef100_A7PW47 Cluster: Adenylyl-s... 66 4e-10
>gnl|LJGI|BP068063 similar to UniRef100_O49204 Cluster: Adenylyl-sulfate kinase,
chloroplast precursor; n=1; Catharanthus roseus|Rep:
Adenylyl-sulfate kinase, chloroplast precursor -
Catharanthus roseus (Rosy periwinkle) (Madagascar
periwinkle), partial (26%)
Length = 520
Score = 454 bits (229), Expect = e-127
Identities = 254/261 (97%), Gaps = 1/261 (0%)
Strand = Plus / Plus
Query: 689 tactgccagaaggagatttcattgaggttttcttagacgtaccac-taaatgtgtgcgaa 747
||||||||||||||||| |||||||||||| |||||||||||||| ||||||||| ||||
Sbjct: 1 tactgccagaaggagatgtcattgaggtttacttagacgtaccacgtaaatgtgtacgaa 60
Query: 748 gcaagggacccaaagggactctacaagcttgctcgaacaggaaagatcaaaggttttaca 807
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 61 gcaagggacccaaagggactctacaagcttgctcgaacaggaaagatcaaaggttggaca 120
Query: 808 gggatagatgatccatatgaacccccaagtagttgtgagatagttgtacagcaaaaagga 867
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 121 gggatagatgatccatatgaacccccaagtagtagtgagatagttgtacagcaaaaagga 180
Query: 868 agtaattgtatgtctccgagtgatacggcagaaatagtaatatcctacttggataagaat 927
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 agtaattgtatgtctccgagtgatacggcagaaatagtaatatcctacttggataagaat 240
Query: 928 ggttacctgcgagtctgattt 948
|||||||||||||||||||||
Sbjct: 241 ggttacctgcgagtctgattt 261
>gnl|LJGI|TC57721 similar to UniRef100_A7PLQ7 Cluster: Adenylyl-sulfate kinase; n=1;
Vitis vinifera|Rep: Adenylyl-sulfate kinase - Vitis
vinifera (Grape), complete
Length = 1180
Score = 446 bits (225), Expect = e-124
Identities = 486/573 (84%)
Strand = Plus / Plus
Query: 346 aacattttgtggcatgaatgtccagtccagaagcatgatagagagcaactacttcagcaa 405
||||||||||||||||| |||||| | ||||| || |||||| || | || ||||||||
Sbjct: 94 aacattttgtggcatgactgtccaattcagaaacaggatagacagaagctgcttcagcag 153
Query: 406 aaaggttgcgttgtttggttaactggtctcagtggttcagggaaaagtactctggcatgt 465
||||| || ||| | ||| ||||||| ||||| ||||||||||||||| |||| |||||
Sbjct: 154 aaaggatgtgttatatggctaactggcctcagcggttcagggaaaagttctcttgcatgc 213
Query: 466 gctttgagtcgaagcttgcactccagagggaagttgacttatatcctcgatggtgacaat 525
|||||||||| |||||||||||||||||| || || ||||| |||| |||||||||||
Sbjct: 214 gctttgagtcaaagcttgcactccagaggaaaactgtcttatgtccttgatggtgacaac 273
Query: 526 attcgacatggtctaaaccgtgatcttagttttagagcagaagatcgttcagagaacatc 585
||||| |||||||| ||||||||||||||||||| |||||||||||||||||| |||||
Sbjct: 274 attcggcatggtctgaaccgtgatcttagttttaaagcagaagatcgttcagaaaacata 333
Query: 586 cgcaggattggtgaggtagcaaaactcttggcagatgcaggtgtaatttgcatcgcgagt 645
|| || ||||||||||| || |||||||| |||||||| ||||| ||||||||| | |||
Sbjct: 334 cgaagaattggtgaggtggccaaactctttgcagatgccggtgttatttgcatcactagt 393
Query: 646 ttaatatcgccctaccaaaaggacagggacgcttgccgagctctactgccagaaggagat 705
|||||||| || |||| |||||| || || |||||| |||| || |||||| ||||||||
Sbjct: 394 ttaatatccccttaccgaaaggatagagatgcttgcagagcactgctgccaaaaggagat 453
Query: 706 ttcattgaggttttcttagacgtaccactaaatgtgtgcgaagcaagggacccaaaggga 765
|| | ||||||||| ||||||| || ||| ||||||| ||||| ||||||||||| ||
Sbjct: 454 tttgtcgaggttttcatagacgtgccgctacatgtgtgtgaagctagggacccaaaaggc 513
Query: 766 ctctacaagcttgctcgaacaggaaagatcaaaggttttacagggatagatgatccatat 825
||||||||||| |||||| | ||||||||||||||||| || || |||||||||||||||
Sbjct: 514 ctctacaagctcgctcgagctggaaagatcaaaggtttcactggtatagatgatccatat 573
Query: 826 gaacccccaagtagttgtgagatagttgtacagcaaaaaggaagtaattgtatgtctccg 885
||||| || |||| ||||||||||| |||| || ||||||||| |||| | ||||||
Sbjct: 574 gaaccaccgtgtagctgtgagatagtgttacaacagaaaggaagtgattgcaagtctcct 633
Query: 886 agtgatacggcagaaatagtaatatcctacttg 918
| |||| ||| |||||||| ||||| ||||||
Sbjct: 634 aatgatttggctgaaatagtgatatcttacttg 666
>gnl|LJGI|FS320128 similar to UniRef100_A2ZG75 Cluster: Adenylyl-sulfate kinase; n=2;
Oryza sativa|Rep: Adenylyl-sulfate kinase - Oryza sativa
subsp. indica (Rice), partial (35%)
Length = 726
Score = 266 bits (134), Expect = 2e-70
Identities = 254/294 (86%)
Strand = Plus / Plus
Query: 346 aacattttgtggcatgaatgtccagtccagaagcatgatagagagcaactacttcagcaa 405
||||||||||||||||| |||||| | ||||| || |||||| || | || ||||||||
Sbjct: 426 aacattttgtggcatgactgtccaattcagaaacaggatagacagaagctgcttcagcag 485
Query: 406 aaaggttgcgttgtttggttaactggtctcagtggttcagggaaaagtactctggcatgt 465
||||| || ||| | ||| ||||||| ||||| ||||||||||||||| |||| |||||
Sbjct: 486 aaaggatgtgttatatggctaactggcctcagcggttcagggaaaagttctcttgcatgc 545
Query: 466 gctttgagtcgaagcttgcactccagagggaagttgacttatatcctcgatggtgacaat 525
|||||||||| |||||||||||||||||| || || ||||| |||| |||||||||||
Sbjct: 546 gctttgagtcaaagcttgcactccagaggaaaactgtcttatgtccttgatggtgacaac 605
Query: 526 attcgacatggtctaaaccgtgatcttagttttagagcagaagatcgttcagagaacatc 585
||||| |||||||| ||||||||||||||||||| |||||||||||||||||| |||||
Sbjct: 606 attcggcatggtctgaaccgtgatcttagttttaaagcagaagatcgttcagaaaacata 665
Query: 586 cgcaggattggtgaggtagcaaaactcttggcagatgcaggtgtaatttgcatc 639
|| || ||||||||||| || |||||||| |||||||| ||||| |||||||||
Sbjct: 666 cgaagaattggtgaggtggccaaactctttgcagatgccggtgttatttgcatc 719
>gnl|LJGI|TC57974 similar to UniRef100_A7PW47 Cluster: Adenylyl-sulfate kinase; n=1;
Vitis vinifera|Rep: Adenylyl-sulfate kinase - Vitis
vinifera (Grape), partial (96%)
Length = 1177
Score = 65.9 bits (33), Expect = 4e-10
Identities = 57/65 (87%)
Strand = Plus / Plus
Query: 766 ctctacaagcttgctcgaacaggaaagatcaaaggttttacagggatagatgatccatat 825
||||| ||||||||||| | |||||||||||||||||||| || || |||||||| |||
Sbjct: 754 ctctataagcttgctcgtgctggaaagatcaaaggttttactggcattgatgatccttat 813
Query: 826 gaacc 830
|||||
Sbjct: 814 gaacc 818