Miyakogusa Predicted Gene

Lj2g3v1968370.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1968370.1 tr|C6TL96|C6TL96_SOYBN Adenylyl-sulfate kinase
OS=Glycine max GN=Gma.40304 PE=2
SV=1,76.13,0,APS_kinase,Adenylylsulphate kinase; apsK: adenylylsulfate
kinase,Adenylylsulphate kinase; ADENYLSULF,CUFF.38120.1
         (948 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP068063 similar to UniRef100_O49204 Cluster: Adenylyl-...   454   e-127
gnl|LJGI|TC57721 similar to UniRef100_A7PLQ7 Cluster: Adenylyl-s...   446   e-124
gnl|LJGI|FS320128 similar to UniRef100_A2ZG75 Cluster: Adenylyl-...   266   2e-70
gnl|LJGI|TC57974 similar to UniRef100_A7PW47 Cluster: Adenylyl-s...    66   4e-10

>gnl|LJGI|BP068063 similar to UniRef100_O49204 Cluster: Adenylyl-sulfate kinase,
           chloroplast precursor; n=1; Catharanthus roseus|Rep:
           Adenylyl-sulfate kinase, chloroplast precursor -
           Catharanthus roseus (Rosy periwinkle) (Madagascar
           periwinkle), partial (26%)
          Length = 520

 Score =  454 bits (229), Expect = e-127
 Identities = 254/261 (97%), Gaps = 1/261 (0%)
 Strand = Plus / Plus

                                                                       
Query: 689 tactgccagaaggagatttcattgaggttttcttagacgtaccac-taaatgtgtgcgaa 747
           ||||||||||||||||| |||||||||||| |||||||||||||| ||||||||| ||||
Sbjct: 1   tactgccagaaggagatgtcattgaggtttacttagacgtaccacgtaaatgtgtacgaa 60

                                                                       
Query: 748 gcaagggacccaaagggactctacaagcttgctcgaacaggaaagatcaaaggttttaca 807
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||
Sbjct: 61  gcaagggacccaaagggactctacaagcttgctcgaacaggaaagatcaaaggttggaca 120

                                                                       
Query: 808 gggatagatgatccatatgaacccccaagtagttgtgagatagttgtacagcaaaaagga 867
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 121 gggatagatgatccatatgaacccccaagtagtagtgagatagttgtacagcaaaaagga 180

                                                                       
Query: 868 agtaattgtatgtctccgagtgatacggcagaaatagtaatatcctacttggataagaat 927
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 agtaattgtatgtctccgagtgatacggcagaaatagtaatatcctacttggataagaat 240

                                
Query: 928 ggttacctgcgagtctgattt 948
           |||||||||||||||||||||
Sbjct: 241 ggttacctgcgagtctgattt 261


>gnl|LJGI|TC57721 similar to UniRef100_A7PLQ7 Cluster: Adenylyl-sulfate kinase; n=1;
           Vitis vinifera|Rep: Adenylyl-sulfate kinase - Vitis
           vinifera (Grape), complete
          Length = 1180

 Score =  446 bits (225), Expect = e-124
 Identities = 486/573 (84%)
 Strand = Plus / Plus

                                                                       
Query: 346 aacattttgtggcatgaatgtccagtccagaagcatgatagagagcaactacttcagcaa 405
           ||||||||||||||||| |||||| | ||||| || |||||| || | || |||||||| 
Sbjct: 94  aacattttgtggcatgactgtccaattcagaaacaggatagacagaagctgcttcagcag 153

                                                                       
Query: 406 aaaggttgcgttgtttggttaactggtctcagtggttcagggaaaagtactctggcatgt 465
           ||||| || ||| | ||| ||||||| ||||| ||||||||||||||| |||| ||||| 
Sbjct: 154 aaaggatgtgttatatggctaactggcctcagcggttcagggaaaagttctcttgcatgc 213

                                                                       
Query: 466 gctttgagtcgaagcttgcactccagagggaagttgacttatatcctcgatggtgacaat 525
           |||||||||| |||||||||||||||||| ||  || ||||| |||| ||||||||||| 
Sbjct: 214 gctttgagtcaaagcttgcactccagaggaaaactgtcttatgtccttgatggtgacaac 273

                                                                       
Query: 526 attcgacatggtctaaaccgtgatcttagttttagagcagaagatcgttcagagaacatc 585
           ||||| |||||||| ||||||||||||||||||| |||||||||||||||||| ||||| 
Sbjct: 274 attcggcatggtctgaaccgtgatcttagttttaaagcagaagatcgttcagaaaacata 333

                                                                       
Query: 586 cgcaggattggtgaggtagcaaaactcttggcagatgcaggtgtaatttgcatcgcgagt 645
           || || ||||||||||| || |||||||| |||||||| ||||| ||||||||| | |||
Sbjct: 334 cgaagaattggtgaggtggccaaactctttgcagatgccggtgttatttgcatcactagt 393

                                                                       
Query: 646 ttaatatcgccctaccaaaaggacagggacgcttgccgagctctactgccagaaggagat 705
           |||||||| || |||| |||||| || || |||||| |||| || |||||| ||||||||
Sbjct: 394 ttaatatccccttaccgaaaggatagagatgcttgcagagcactgctgccaaaaggagat 453

                                                                       
Query: 706 ttcattgaggttttcttagacgtaccactaaatgtgtgcgaagcaagggacccaaaggga 765
           ||  | ||||||||| ||||||| || ||| ||||||| ||||| ||||||||||| || 
Sbjct: 454 tttgtcgaggttttcatagacgtgccgctacatgtgtgtgaagctagggacccaaaaggc 513

                                                                       
Query: 766 ctctacaagcttgctcgaacaggaaagatcaaaggttttacagggatagatgatccatat 825
           ||||||||||| |||||| | ||||||||||||||||| || || |||||||||||||||
Sbjct: 514 ctctacaagctcgctcgagctggaaagatcaaaggtttcactggtatagatgatccatat 573

                                                                       
Query: 826 gaacccccaagtagttgtgagatagttgtacagcaaaaaggaagtaattgtatgtctccg 885
           ||||| ||  |||| |||||||||||  |||| || ||||||||| |||| | |||||| 
Sbjct: 574 gaaccaccgtgtagctgtgagatagtgttacaacagaaaggaagtgattgcaagtctcct 633

                                            
Query: 886 agtgatacggcagaaatagtaatatcctacttg 918
           | ||||  ||| |||||||| ||||| ||||||
Sbjct: 634 aatgatttggctgaaatagtgatatcttacttg 666


>gnl|LJGI|FS320128 similar to UniRef100_A2ZG75 Cluster: Adenylyl-sulfate kinase; n=2;
           Oryza sativa|Rep: Adenylyl-sulfate kinase - Oryza sativa
           subsp. indica (Rice), partial (35%)
          Length = 726

 Score =  266 bits (134), Expect = 2e-70
 Identities = 254/294 (86%)
 Strand = Plus / Plus

                                                                       
Query: 346 aacattttgtggcatgaatgtccagtccagaagcatgatagagagcaactacttcagcaa 405
           ||||||||||||||||| |||||| | ||||| || |||||| || | || |||||||| 
Sbjct: 426 aacattttgtggcatgactgtccaattcagaaacaggatagacagaagctgcttcagcag 485

                                                                       
Query: 406 aaaggttgcgttgtttggttaactggtctcagtggttcagggaaaagtactctggcatgt 465
           ||||| || ||| | ||| ||||||| ||||| ||||||||||||||| |||| ||||| 
Sbjct: 486 aaaggatgtgttatatggctaactggcctcagcggttcagggaaaagttctcttgcatgc 545

                                                                       
Query: 466 gctttgagtcgaagcttgcactccagagggaagttgacttatatcctcgatggtgacaat 525
           |||||||||| |||||||||||||||||| ||  || ||||| |||| ||||||||||| 
Sbjct: 546 gctttgagtcaaagcttgcactccagaggaaaactgtcttatgtccttgatggtgacaac 605

                                                                       
Query: 526 attcgacatggtctaaaccgtgatcttagttttagagcagaagatcgttcagagaacatc 585
           ||||| |||||||| ||||||||||||||||||| |||||||||||||||||| ||||| 
Sbjct: 606 attcggcatggtctgaaccgtgatcttagttttaaagcagaagatcgttcagaaaacata 665

                                                                 
Query: 586 cgcaggattggtgaggtagcaaaactcttggcagatgcaggtgtaatttgcatc 639
           || || ||||||||||| || |||||||| |||||||| ||||| |||||||||
Sbjct: 666 cgaagaattggtgaggtggccaaactctttgcagatgccggtgttatttgcatc 719


>gnl|LJGI|TC57974 similar to UniRef100_A7PW47 Cluster: Adenylyl-sulfate kinase; n=1;
           Vitis vinifera|Rep: Adenylyl-sulfate kinase - Vitis
           vinifera (Grape), partial (96%)
          Length = 1177

 Score = 65.9 bits (33), Expect = 4e-10
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 766 ctctacaagcttgctcgaacaggaaagatcaaaggttttacagggatagatgatccatat 825
           ||||| |||||||||||  | |||||||||||||||||||| || || |||||||| |||
Sbjct: 754 ctctataagcttgctcgtgctggaaagatcaaaggttttactggcattgatgatccttat 813

                
Query: 826 gaacc 830
           |||||
Sbjct: 814 gaacc 818