Miyakogusa Predicted Gene

Lj2g3v1903290.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1903290.1 tr|I6WTY1|I6WTY1_9GLOM NADH-ubiquinone
oxidoreductase chain 5 OS=Rhizophagus irregularis GN=nad5
PE=,33.33,0.23,seg,NULL,CUFF.38042.1
         (393 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|CB827389                                                     167   6e-41
gnl|LJGI|BP047548                                                      60   1e-08
gnl|LJGI|TC76948 similar to UniRef100_Q94A20 Cluster: Protein FB...    52   3e-06
gnl|LJGI|TC63259 similar to UniRef100_Q94A20 Cluster: Protein FB...    52   3e-06

>gnl|LJGI|CB827389 
          Length = 497

 Score =  167 bits (84), Expect = 6e-41
 Identities = 129/144 (89%), Gaps = 10/144 (6%)
 Strand = Plus / Plus

                                                                       
Query: 14  ctgggatcttcatttgggtttatgggttttcttcatctaggaatgctgggtttgctattt 73
           ||||| ||||||||| ||||| ||||||||||||||||         ||||||||| |||
Sbjct: 361 ctgggttcttcattttggtttctgggttttcttcatct---------gggtttgcttttt 411

                                                                       
Query: 74  caatttgggttttctgttacaatctgggtttgctggttctgatcccccaccactcactct 133
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 412 caatttgggttttctgttacaatctgg-tttgctggttctgatcccccaccactcactct 470

                                   
Query: 134 ttttctttcctctctctaaatttg 157
           ||| ||||||||||||||||||||
Sbjct: 471 tttcctttcctctctctaaatttg 494


>gnl|LJGI|BP047548 
          Length = 361

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 58/66 (87%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                       
Query: 93  caatctgggtttgctggttctgatcccccaccactca-ctctttttctttcctctctcta 151
           |||| ||||||| ||||||  |||||||||||||||| ||||||  | ||||||||||||
Sbjct: 291 caatttgggtttcctggtttggatcccccaccactcacctctttgccattcctctctcta 232

                 
Query: 152 aatttg 157
           ||||||
Sbjct: 231 aatttg 226


>gnl|LJGI|TC76948 similar to UniRef100_Q94A20 Cluster: Protein FBL4; n=1; Arabidopsis
           thaliana|Rep: Protein FBL4 - Arabidopsis thaliana
           (Mouse-ear cress), partial (13%)
          Length = 776

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 45/50 (90%), Gaps = 1/50 (2%)
 Strand = Plus / Minus

                                                             
Query: 59  ctgggtttgctatttcaatttggg-ttttctgttacaatctgggtttgct 107
           |||||||| || |||||||||||| |||||| || |||||||||||||||
Sbjct: 143 ctgggtttactttttcaatttggggttttctatttcaatctgggtttgct 94


>gnl|LJGI|TC63259 similar to UniRef100_Q94A20 Cluster: Protein FBL4; n=1; Arabidopsis
           thaliana|Rep: Protein FBL4 - Arabidopsis thaliana
           (Mouse-ear cress), partial (13%)
          Length = 687

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 45/50 (90%), Gaps = 1/50 (2%)
 Strand = Plus / Plus

                                                             
Query: 59  ctgggtttgctatttcaatttggg-ttttctgttacaatctgggtttgct 107
           |||||||| || |||||||||||| |||||| || |||||||||||||||
Sbjct: 441 ctgggtttactttttcaatttggggttttctatttcaatctgggtttgct 490