Miyakogusa Predicted Gene

Lj2g3v1734460.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1734460.1 tr|K1RZC1|K1RZC1_CRAGI Latrophilin-2
OS=Crassostrea gigas PE=4 SV=1,28.17,3.5,seg,NULL,CUFF.37946.1
         (241 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS338882                                                      56   1e-07

>gnl|LJGI|FS338882 
          Length = 763

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 1   atgtgcttagttacatattgtttagagaatctgata 36
           ||||||||||||||||||||| |||| |||||||||
Sbjct: 704 atgtgcttagttacatattgtgtagataatctgata 739