Miyakogusa Predicted Gene

Lj2g3v1732370.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1732370.1 tr|J4KQD5|J4KQD5_BEAB2 Integral membrane protein
OS=Beauveria bassiana (strain ARSEF 2860) PE=4
SV=1,26.51,6.4,seg,NULL,CUFF.37938.1
         (248 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS338882                                                      62   2e-09

>gnl|LJGI|FS338882 
          Length = 763

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                  
Query: 22  gtaatgtgcttagttacatattgtttagagaatctgata 60
           |||||||||||||||||||||||| |||| |||||||||
Sbjct: 701 gtaatgtgcttagttacatattgtgtagataatctgata 739