Miyakogusa Predicted Gene

Lj2g3v1730230.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1730230.1 Non Chatacterized Hit- tr|B9RPI9|B9RPI9_RICCO
Putative uncharacterized protein OS=Ricinus communis
G,60.61,0.0000000000001,seg,NULL; coiled-coil,NULL,CUFF.37908.1
         (1281 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW623153 similar to UniRef100_A7PUR9 Cluster: Chromosom...   918   0.0  
gnl|LJGI|BW599245 homologue to UniRef100_A8TSW4 Cluster: Asp/Glu...   123   3e-27
gnl|LJGI|TC70929 similar to UniRef100_O82090 Cluster: Fiber anne...    56   6e-07
gnl|LJGI|AV408579                                                      54   2e-06

>gnl|LJGI|BW623153 similar to UniRef100_A7PUR9 Cluster: Chromosome chr4 scaffold_32,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr4 scaffold_32, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (32%)
          Length = 482

 Score =  918 bits (463), Expect = 0.0
 Identities = 469/471 (99%)
 Strand = Plus / Plus

                                                                       
Query: 384 aaaacctgaacttgaagacaagcaggtgaatggtgtctgtggtggtgaacttgatagaag 443
           |||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||
Sbjct: 12  aaaacctgaacttgaagacaagcaggcgtatggtgtctgtggtggtgaacttgatagaag 71

                                                                       
Query: 444 caatggacacagagaacctgaaaacggtagcttgacggatgttttactcagggaaaaggc 503
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72  caatggacacagagaacctgaaaacggtagcttgacggatgttttactcagggaaaaggc 131

                                                                       
Query: 504 actggcattgaattcggaaagagatagagagattgaagacttctttgacacacaagattc 563
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 132 actggcattgaattcggaaagagatagagagattgaagacttctttgacacacaagattc 191

                                                                       
Query: 564 gttgagtttcacaagtaatacagatggagaggataatgcagggacagaactgtctatgaa 623
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 192 gttgagtttcacaagtaatacagatggagaggataatgcagggacagaactgtctatgaa 251

                                                                       
Query: 624 attcagcagtcctggaggggagttttatgatgcttgggaagaactatcttccaaaggcac 683
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 252 attcagcagtcctggaggggagttttatgatgcttgggaagaactatcttccaaaggcac 311

                                                                       
Query: 684 gcctcaaaaatctactacatatgatgttgaagctgaattgcgtgaaatgaggttgagtct 743
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312 gcctcaaaaatctactacatatgatgttgaagctgaattgcgtgaaatgaggttgagtct 371

                                                                       
Query: 744 attgatggagatagagaagcggaagcaagctgaagaatccctgaataacttcagaaacca 803
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 372 attgatggagatagagaagcggaagcaagctgaagaatccctgaataacttcagaaacca 431

                                                              
Query: 804 atgggagagtgttaggcaagggttatgtcaggcaggaattattttgccttc 854
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 432 atgggagagtgttaggcaagggttatgtcaggcaggaattattttgccttc 482


>gnl|LJGI|BW599245 homologue to UniRef100_A8TSW4 Cluster: Asp/Glu racemase; n=1; alpha
            proteobacterium BAL199|Rep: Asp/Glu racemase - alpha,
            partial (4%)
          Length = 474

 Score =  123 bits (62), Expect = 3e-27
 Identities = 144/166 (86%), Gaps = 4/166 (2%)
 Strand = Plus / Plus

                                                                        
Query: 1103 agatggcacggcgggagaggcaaagaaaaagtaggagacaaagatggatttggggctccc 1162
            |||||||||||| ||||||||||| |  || || || || || |||| ||||||||||||
Sbjct: 34   agatggcacggcaggagaggcaaaaagtaactacgatactaatatgggtttggggctccc 93

                                                                        
Query: 1163 ttacgactgtgattgcacttagtactgcagcaat-agcatggt-cttatctcccaacagg 1220
            ||||||||| |||||||||| || ||||  | |  |||||||| ||||||||||||||||
Sbjct: 94   ttacgactgcgattgcacttcgtgctgctccgagcagcatggtacttatctcccaacagg 153

                                                          
Query: 1221 taacg-gatcatcctctgcagacgatcatc-tggttcccgaacatg 1264
            ||||  |||||||||||||||||||||||| |||||||||||||||
Sbjct: 154  taactcgatcatcctctgcagacgatcatcttggttcccgaacatg 199


>gnl|LJGI|TC70929 similar to UniRef100_O82090 Cluster: Fiber annexin; n=1; Gossypium
           hirsutum|Rep: Fiber annexin - Gossypium hirsutum (Upland
           cotton) (Gossypium mexicanum), partial (35%)
          Length = 981

 Score = 56.0 bits (28), Expect = 6e-07
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 923 tttatgttgctaggttcatatcaaatattgtcgggagaggaactgtcagggctgaggtag 982
           ||||||||||||||||||||| ||||  | | |||||||||| |||||| || ||| |||
Sbjct: 639 tttatgttgctaggttcatatgaaatcctattgggagaggaaatgtcagagccgagatag 698

                           
Query: 983 agaaggagatggaagc 998
           ||| |||  |||||||
Sbjct: 699 agagggaattggaagc 714


>gnl|LJGI|AV408579 
          Length = 405

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 1   atgccgacttttactgccatagcattggataccttgttagagcctgg 47
           |||||||| ||||||||||||||||| ||||  ||| ||||||||||
Sbjct: 206 atgccgacctttactgccatagcatttgataggttgatagagcctgg 252