Miyakogusa Predicted Gene

Lj2g3v1728850.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1728850.2 Non Chatacterized Hit- tr|K4DXZ9|K4DXZ9_TRYCR
Uncharacterized protein OS=Trypanosoma cruzi PE=4
SV=1,27.78,2.6,seg,NULL,CUFF.37735.2
         (338 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58439 similar to UniRef100_Q0GPH8 Cluster: BZIP trans...    82   2e-15

>gnl|LJGI|TC58439 similar to UniRef100_Q0GPH8 Cluster: BZIP transcription factor
           bZIP56; n=1; Glycine max|Rep: BZIP transcription factor
           bZIP56 - Glycine max (Soybean), partial (43%)
          Length = 847

 Score = 81.8 bits (41), Expect = 2e-15
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                       
Query: 248 cacacacacacgcgacgatggctcttccacccgggaagctcaccattctcctcggtgcag 307
           |||||| ||||||| ||||||||||| ||| ||||||||||||||| |||||||||||||
Sbjct: 220 cacacatacacgcgccgatggctctttcactcgggaagctcaccatcctcctcggtgcag 279

            
Query: 308 g 308
           |
Sbjct: 280 g 280