Miyakogusa Predicted Gene

Lj2g3v1717610.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1717610.1 tr|D7LYV7|D7LYV7_ARALL Predicted protein
OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_663183
PE,34.59,1e-17,FBOX,F-box domain, cyclin-like; F-box-like,NULL;
LRR_6,NULL; N7-RELATED PROTEIN,NULL; F-BOX/LEUCINE ,CUFF.37704.1
         (1020 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82289 weakly similar to UniRef100_Q2HSK3 Cluster: Cyc...    80   3e-14
gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 ...    64   2e-09
gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyc...    62   7e-09
gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-lik...    52   7e-06

>gnl|LJGI|TC82289 weakly similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (50%)
          Length = 1365

 Score = 79.8 bits (40), Expect = 3e-14
 Identities = 118/144 (81%)
 Strand = Plus / Plus

                                                                       
Query: 169 tggcttaaacttccaagagaattgacaacaaacatacttcaaaggcttagtgtggaagaa 228
           |||||| ||||||||| |||  | ||||||| ||||||||||| ||||| |     ||||
Sbjct: 821 tggcttgaacttccaaaagagctaacaacaatcatacttcaaaagcttaataccatagaa 880

                                                                       
Query: 229 attttgatgagtgcaagtcaagtgtgctctttatggtggagcatctacaaggatcctctc 288
           ||| |||  |||||||| | |||||||||||| ||||||| ||| |  |||||||| |||
Sbjct: 881 attgtgacaagtgcaagcccagtgtgctctttgtggtggaacatttgtaaggatccactc 940

                                   
Query: 289 atgtggcgcaccattgacatgatc 312
           |||||| |||| ||||||||||||
Sbjct: 941 atgtggtgcactattgacatgatc 964



 Score = 61.9 bits (31), Expect = 7e-09
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 539  tgttagaggagattgacatttcatttaccaatctatctaaggattctcttgaagctatt 597
            ||||||| ||| |||||||||||| || ||||||| |||||||||||||  ||||||||
Sbjct: 1185 tgttagaagagcttgacatttcatatagcaatctaactaaggattctctgaaagctatt 1243


>gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 protein; n=1;
           Medicago truncatula|Rep: N7 protein - Medicago
           truncatula (Barrel medic), partial (34%)
          Length = 1017

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 95/116 (81%)
 Strand = Plus / Plus

                                                                       
Query: 677 ctattgcaaaaaccatgcctgagctttgtcatctagagatctcaagaatcaagatcagta 736
           |||||||||||||||||||| |||| ||||||||  || | |   ||| || | ||| ||
Sbjct: 670 ctattgcaaaaaccatgcctcagctgtgtcatcttcagcttttgggaaacaggctcacta 729

                                                                   
Query: 737 ataaaggcttggttgctatactagatggttgccctcagcttgagtatcttgacctg 792
           |||| |||||| ||||||| || ||||| |||||||| ||||| | ||||||||||
Sbjct: 730 ataacggcttgattgctattcttgatgggtgccctcatcttgaatctcttgacctg 785


>gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (28%)
          Length = 823

 Score = 61.9 bits (31), Expect = 7e-09
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 539 tgttagaggagattgacatttcatttaccaatctatctaaggattctcttgaagctatt 597
           ||||||| ||| |||||||||||| || ||||||| |||||||||||||  ||||||||
Sbjct: 179 tgttagaagagcttgacatttcatatagcaatctaactaaggattctctgaaagctatt 237



 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 731 tcagtaataaaggcttggttgctatactagatggttgccctcagcttgagtatcttgacc 790
           |||||||| ||||||||| ||| || || |||||||| ||||  ||||| ||||||||||
Sbjct: 365 tcagtaatgaaggcttggatgccattcttgatggttgtcctcttcttgaatatcttgacc 424

             
Query: 791 tg 792
           ||
Sbjct: 425 tg 426


>gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (37%)
          Length = 840

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 522 tgtgaagaagctcccaatgttagaggagattgacatttcatttaccaatctatctaagga 581
           |||||||| ||| ||| | ||||||||| | ||||||||||||||||  | | ||||| |
Sbjct: 155 tgtgaagaggcttccactcttagaggagctcgacatttcatttaccatacaacctaagta 214

                             
Query: 582 ttctcttgaagctattgg 599
           ||  ||||||||||||||
Sbjct: 215 tttccttgaagctattgg 232



 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                       
Query: 731 tcagtaataaaggcttggttgctatactagatggttgccctcagcttgagtatcttgacc 790
           |||||||| | |||||| ||||||| || |||||||||||||  || || ||||||||||
Sbjct: 385 tcagtaatgatggcttgcttgctattcttgatggttgccctcttctcgaatatcttgacc 444

                                                 
Query: 791 tgaaatcttgtcttggtcttgatttgagtggaagtttg 828
           |  ||  ||||| |  | ||||||||||||| ||||||
Sbjct: 445 tacaaggttgtccttttgttgatttgagtggtagtttg 482