Miyakogusa Predicted Gene

Lj2g3v1670810.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1670810.1 Non Chatacterized Hit- tr|I3SSZ9|I3SSZ9_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=4 SV=1,71.43,0.00002,
,CUFF.37635.1
         (165 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64999 similar to UniRef100_Q9ZRG5 Cluster: Peroxidase...    78   2e-14

>gnl|LJGI|TC64999 similar to UniRef100_Q9ZRG5 Cluster: Peroxidase; n=1; Glycine
           max|Rep: Peroxidase - Glycine max (Soybean), partial
           (71%)
          Length = 726

 Score = 77.8 bits (39), Expect = 2e-14
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgtggaaggttggcgctggtaattatatggtttcactggccttagatgttcttccatcc 60
           |||| ||||||||| ||||||| || | |||||||||||||||  ||| |||||||||||
Sbjct: 533 atgttgaaggttggtgctggtagttgtgtggtttcactggcctgggattttcttccatcc 474

                                  
Query: 61  tttctccctttagaaacatccca 83
           ||||| |||||||  ||||||||
Sbjct: 473 tttcttcctttaggtacatccca 451