Miyakogusa Predicted Gene

Lj2g3v1575360.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1575360.1 tr|I1LID5|I1LID5_SOYBN Thioredoxin reductase
OS=Glycine max GN=Gma.15493 PE=3 SV=1,80.56,0.00000006,
,NODE_34694_length_86_cov_337.976746.path2.1
         (109 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63269 homologue to UniRef100_A6XJ26 Cluster: Thioredo...   216   2e-56
gnl|LJGI|TC73407 homologue to UniRef100_A6XJ26 Cluster: Thioredo...   149   4e-36

>gnl|LJGI|TC63269 homologue to UniRef100_A6XJ26 Cluster: Thioredoxin reductase; n=1;
           Medicago truncatula|Rep: Thioredoxin reductase -
           Medicago truncatula (Barrel medic), partial (58%)
          Length = 1031

 Score =  216 bits (109), Expect = 2e-56
 Identities = 109/109 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagagcaaggcgttgagcaatagcaagatcaaggtgatatggaactcggctgtggtc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 264 atgcagagcaaggcgttgagcaatagcaagatcaaggtgatatggaactcggctgtggtc 323

                                                            
Query: 61  gaggcgtatggggagggagatagcaagagggttcttggtgggctgaagg 109
           |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 gaggcgtatggggagggagatagcaagagggttcttggtgggctgaagg 372


>gnl|LJGI|TC73407 homologue to UniRef100_A6XJ26 Cluster: Thioredoxin reductase; n=1;
           Medicago truncatula|Rep: Thioredoxin reductase -
           Medicago truncatula (Barrel medic), partial (58%)
          Length = 810

 Score =  149 bits (75), Expect = 4e-36
 Identities = 75/75 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagagcaaggcgttgagcaatagcaagatcaaggtgatatggaactcggctgtggtc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 736 atgcagagcaaggcgttgagcaatagcaagatcaaggtgatatggaactcggctgtggtc 795

                          
Query: 61  gaggcgtatggggag 75
           |||||||||||||||
Sbjct: 796 gaggcgtatggggag 810