Miyakogusa Predicted Gene

Lj2g3v1561960.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1561960.1 tr|Q8LP14|Q8LP14_PEA Nine-cis-epoxycarotenoid
dioxygenase4 OS=Pisum sativum GN=nced4 PE=2
SV=1,82.9,0,RPE65,Carotenoid oxygenase; 9-CIS-EPOXYCAROTENOID
DIOXYGENASE,NULL; BETA-CAROTENE DIOXYGENASE,Carote,CUFF.37529.1
         (837 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC73259 similar to UniRef100_Q8LP14 Cluster: Nine-cis-e...    58   9e-08

>gnl|LJGI|TC73259 similar to UniRef100_Q8LP14 Cluster: Nine-cis-epoxycarotenoid
           dioxygenase4; n=1; Pisum sativum|Rep:
           Nine-cis-epoxycarotenoid dioxygenase4 - Pisum sativum
           (Garden pea), partial (22%)
          Length = 663

 Score = 58.0 bits (29), Expect = 9e-08
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                        
Query: 809 ggaagaggaggatgatgggtacttggtga 837
           |||||||||||||||||||||||||||||
Sbjct: 194 ggaagaggaggatgatgggtacttggtga 222