Miyakogusa Predicted Gene

Lj2g3v1550570.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1550570.1 tr|I2EMD1|I2EMD1_ENTSA L-arabinose isomerase
OS=Cronobacter sakazakii ES15 GN=araA PE=3
SV=1,29.25,0.22,seg,NULL,CUFF.37453.1
         (361 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV411639                                                      98   4e-20
gnl|LJGI|BW600711                                                      88   4e-17
gnl|LJGI|TC73856 similar to UniRef100_P09789 Cluster: Glycine-ri...    88   4e-17

>gnl|LJGI|AV411639 
          Length = 329

 Score = 97.6 bits (49), Expect = 4e-20
 Identities = 55/57 (96%)
 Strand = Plus / Plus

                                                                    
Query: 261 tcccatggcagcgccgccacaacctccctctccctcccatggcagcgccgccaccac 317
           |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 156 tcccatggcagcgccgccaccacctccctctccctcccatgccagcgccgccaccac 212


>gnl|LJGI|BW600711 
          Length = 437

 Score = 87.7 bits (44), Expect = 4e-17
 Identities = 47/48 (97%)
 Strand = Plus / Plus

                                                           
Query: 264 catggcagcgccgccacaacctccctctccctcccatggcagcgccgc 311
           ||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 59  catggcagcgccgccaccacctccctctccctcccatggcagcgccgc 106



 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 286 ccctctccctcccatggcagcgccgccaccac 317
           ||||||||||| ||||||||||||||||||||
Sbjct: 47  ccctctccctctcatggcagcgccgccaccac 78


>gnl|LJGI|TC73856 similar to UniRef100_P09789 Cluster: Glycine-rich cell wall
           structural protein 1 precursor; n=1; Petunia x
           hybrida|Rep: Glycine-rich cell wall structural protein 1
           precursor - Petunia hybrida (Petunia), partial (9%)
          Length = 518

 Score = 87.7 bits (44), Expect = 4e-17
 Identities = 47/48 (97%)
 Strand = Plus / Minus

                                                           
Query: 264 catggcagcgccgccacaacctccctctccctcccatggcagcgccgc 311
           ||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 460 catggcagcgccgccaccacctccctctccctcccatggcagcgccgc 413



 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 286 ccctctccctcccatggcagcgccgccaccac 317
           ||||||||||| ||||||||||||||||||||
Sbjct: 472 ccctctccctctcatggcagcgccgccaccac 441