Miyakogusa Predicted Gene

Lj2g3v1495100.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1495100.1 Non Chatacterized Hit- tr|I1L4Y6|I1L4Y6_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,70.99,0,Homeodomain-like,Homeodomain-like;
Myb_DNA-binding,SANT/Myb domain; SANT  SWI3, ADA2, N-CoR and
TFII,CUFF.37269.1
         (1035 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|NP675421 GB|AB108650.1|BAC75673.1 transcription factor ...   131   1e-29
gnl|LJGI|TC82622 UniRef100_Q84PP5 Cluster: Transcription factor ...   115   6e-25
gnl|LJGI|TC76156 homologue to UniRef100_Q43525 Cluster: Transcri...    94   2e-18
gnl|LJGI|GO012149 similar to UniRef100_A7R2L2 Cluster: Chromosom...    76   5e-13
gnl|LJGI|TC69494 UniRef100_Q84PP4 Cluster: Transcription factor ...    72   8e-12
gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome...    70   3e-11
gnl|LJGI|TC70299 homologue to UniRef100_Q7X9I1 Cluster: MYB tran...    64   2e-09
gnl|LJGI|TC82778 similar to UniRef100_Q58QD0 Cluster: MYB5b; n=1...    62   7e-09
gnl|LJGI|TC68613 similar to UniRef100_Q9S7E3 Cluster: GmMYB29A1 ...    62   7e-09
gnl|LJGI|TC78802 similar to UniRef100_A7Q8B3 Cluster: Chromosome...    60   3e-08
gnl|LJGI|FS344049 homologue to UniRef100_Q9XIU5 Cluster: GmMYB29...    56   5e-07
gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 ...    56   5e-07
gnl|LJGI|TC79087 homologue to UniRef100_Q0PJJ6 Cluster: MYB tran...    54   2e-06

>gnl|LJGI|NP675421 GB|AB108650.1|BAC75673.1 transcription factor MYB103 [Lotus
           japonicus]
          Length = 924

 Score =  131 bits (66), Expect = 1e-29
 Identities = 162/194 (83%)
 Strand = Plus / Plus

                                                                       
Query: 139 ttgaataggtgcggcaagagctgcaggctaaggtggactaactatctcaggccagatatc 198
           ||||| ||||| || ||||| |||||||||||||||||||| ||||| ||||| ||||||
Sbjct: 136 ttgaacaggtgtggaaagagttgcaggctaaggtggactaattatctgaggcctgatatc 195

                                                                       
Query: 199 aagagaggcaaattcactgaagaagaggagcgaatcatcatcaaccttcattcagttctt 258
           ||||| || |||||| |||| |||||||||| | |||||||||| || ||| ||  ||||
Sbjct: 196 aagagggggaaattctctgatgaagaggagcaactcatcatcaatctacatgcatctctt 255

                                                                       
Query: 259 ggaaacaagtggtcgaagattgcagcccatcttccaggaagaactgataatgagatcaag 318
           || || || ||| | |  || ||| | ||||||||||| || |||||||||||||| |||
Sbjct: 256 ggcaataaatgggcaactatagcatctcatcttccagggaggactgataatgagattaag 315

                         
Query: 319 aatttctggaacac 332
           ||||| ||||||||
Sbjct: 316 aatttatggaacac 329


>gnl|LJGI|TC82622 UniRef100_Q84PP5 Cluster: Transcription factor MYB101; n=1; Lotus
           japonicus|Rep: Transcription factor MYB101 - Lotus
           japonicus, partial (98%)
          Length = 1068

 Score =  115 bits (58), Expect = 6e-25
 Identities = 175/214 (81%)
 Strand = Plus / Plus

                                                                       
Query: 119 cacttccaaagcgtgccggtttgaataggtgcggcaagagctgcaggctaaggtggacta 178
           ||||||| |||| ||| ||  |||| |||||||| ||||| |||||||||||||||||||
Sbjct: 137 cacttccgaagcttgcaggactgaacaggtgcgggaagagttgcaggctaaggtggacta 196

                                                                       
Query: 179 actatctcaggccagatatcaagagaggcaaattcactgaagaagaggagcgaatcatca 238
           ||||  | ||||| ||||| || ||||| || |||||||| ||||| |||| | ||||||
Sbjct: 197 actacttgaggcctgatattaaaagaggaaagttcactgaggaagaagagcaactcatca 256

                                                                       
Query: 239 tcaaccttcattcagttcttggaaacaagtggtcgaagattgcagcccatcttccaggaa 298
           ||||  | ||| | |||||||| || ||||||||    || ||||  ||| | ||||| |
Sbjct: 257 tcaatttacatgctgttcttgggaataagtggtctgccatagcaggtcatttgccaggga 316

                                             
Query: 299 gaactgataatgagatcaagaatttctggaacac 332
           | ||||||||||| ||||||||||||||||||||
Sbjct: 317 ggactgataatgaaatcaagaatttctggaacac 350


>gnl|LJGI|TC76156 homologue to UniRef100_Q43525 Cluster: Transcription factor; n=1;
           Solanum lycopersicum|Rep: Transcription factor - Solanum
           lycopersicum (Tomato) (Lycopersicon esculentum), partial
           (61%)
          Length = 1383

 Score = 93.7 bits (47), Expect = 2e-18
 Identities = 80/91 (87%)
 Strand = Plus / Plus

                                                                       
Query: 292 ccaggaagaactgataatgagatcaagaatttctggaacactcacataaggaagaagctt 351
           ||||||||||| || |||||||| ||||||| ||||||||||||||| |||| |||||||
Sbjct: 562 ccaggaagaacagacaatgagataaagaattactggaacactcacatcaggaggaagctt 621

                                          
Query: 352 ctgaagatgggaattgaccctgaaactcaca 382
            |||| |  ||||||||||||| ||||||||
Sbjct: 622 ttgaacagaggaattgaccctgcaactcaca 652


>gnl|LJGI|GO012149 similar to UniRef100_A7R2L2 Cluster: Chromosome undetermined
           scaffold_434, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_434,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (47%)
          Length = 707

 Score = 75.8 bits (38), Expect = 5e-13
 Identities = 71/82 (86%)
 Strand = Plus / Plus

                                                                       
Query: 292 ccaggaagaactgataatgagatcaagaatttctggaacactcacataaggaagaagctt 351
           ||||||||||| || ||||| |||||||| |  |||||||||||||| || |||| ||||
Sbjct: 427 ccaggaagaacagacaatgaaatcaagaactattggaacactcacattagaaagaggctt 486

                                 
Query: 352 ctgaagatgggaattgaccctg 373
           ||||||||||| ||||| ||||
Sbjct: 487 ctgaagatgggtattgatcctg 508


>gnl|LJGI|TC69494 UniRef100_Q84PP4 Cluster: Transcription factor MYB102; n=1; Lotus
           japonicus|Rep: Transcription factor MYB102 - Lotus
           japonicus, complete
          Length = 1245

 Score = 71.9 bits (36), Expect = 8e-12
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                       
Query: 256 cttggaaacaagtggtcgaagattgcagcccatcttccaggaagaactgataatgagatc 315
           ||||||||||| |||||    |||||| | || ||||| ||||||||||| |||||||||
Sbjct: 284 cttggaaacaaatggtcagcaattgcaacacaccttccgggaagaactgacaatgagatc 343

                               
Query: 316 aagaatttctggaacactca 335
           |||||||| |||||||||||
Sbjct: 344 aagaatttttggaacactca 363


>gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome chr14 scaffold_63,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_63, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (65%)
          Length = 1350

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 256 cttggaaacaagtggtcgaagattgcagcccatcttccaggaagaactgataatgagatc 315
           ||||||||||  ||||| ||||||||  | ||||| || |||||||||||||||||||||
Sbjct: 404 cttggaaacagatggtctaagattgcttctcatctccctggaagaactgataatgagatc 463

                                              
Query: 316 aagaatttctggaacactcacataaggaagaagct 350
           |||||   |||||| || ||||||| ||| |||||
Sbjct: 464 aagaaccactggaatacccacataaagaaaaagct 498


>gnl|LJGI|TC70299 homologue to UniRef100_Q7X9I1 Cluster: MYB transcription factor
           R2R3 type; n=1; Populus tremula x Populus
           tremuloides|Rep: MYB transcription factor R2R3 type -
           Populus tremula x Populus tremuloides, partial (64%)
          Length = 1028

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 74/88 (84%)
 Strand = Plus / Plus

                                                                       
Query: 295 ggaagaactgataatgagatcaagaatttctggaacactcacataaggaagaagcttctg 354
           |||||||| || |||||||| ||||||| |||||||||||| ||||| | ||||||| ||
Sbjct: 426 ggaagaacagacaatgagataaagaattactggaacactcatataagaaggaagcttttg 485

                                       
Query: 355 aagatgggaattgaccctgaaactcaca 382
           |  |  |||||||||||||  |||||||
Sbjct: 486 agcagaggaattgaccctgctactcaca 513


>gnl|LJGI|TC82778 similar to UniRef100_Q58QD0 Cluster: MYB5b; n=1; Vitis
           vinifera|Rep: MYB5b - Vitis vinifera (Grape), partial
           (23%)
          Length = 957

 Score = 61.9 bits (31), Expect = 7e-09
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 290 ttccaggaagaactgataatgagatcaagaatttctggaacac 332
           |||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 177 ttccgggaagaactgataatgagataaagaacttctggaacac 219


>gnl|LJGI|TC68613 similar to UniRef100_Q9S7E3 Cluster: GmMYB29A1 protein; n=1;
           Glycine max|Rep: GmMYB29A1 protein - Glycine max
           (Soybean), partial (54%)
          Length = 639

 Score = 61.9 bits (31), Expect = 7e-09
 Identities = 66/77 (85%), Gaps = 3/77 (3%)
 Strand = Plus / Plus

                                                                       
Query: 154 aagagctgcaggctaaggtggactaactatctcaggccagatatcaagagaggcaaattc 213
           ||||||||||| ||| |||||| ||||||| | ||||| |||||||||||||| || |||
Sbjct: 256 aagagctgcagactacggtggattaactatttaaggcctgatatcaagagaggaaatttc 315

                            
Query: 214 a---ctgaagaagagga 227
           |   |||||||||||||
Sbjct: 316 acagctgaagaagagga 332


>gnl|LJGI|TC78802 similar to UniRef100_A7Q8B3 Cluster: Chromosome chr14 scaffold_63,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_63, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (56%)
          Length = 1242

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 87/106 (82%)
 Strand = Plus / Plus

                                                                       
Query: 268 tggtcgaagattgcagcccatcttccaggaagaactgataatgagatcaagaatttctgg 327
           ||||| ||||||||| | |||||||| |||||||| ||||||||||| || ||    |||
Sbjct: 445 tggtctaagattgcaactcatcttcctggaagaacagataatgagattaaaaaccattgg 504

                                                         
Query: 328 aacactcacataaggaagaagcttctgaagatgggaattgaccctg 373
           ||||| ||||||| ||| |||||   ||| ||||||||||| ||||
Sbjct: 505 aacacccacataaagaaaaagctcaagaaaatgggaattgatcctg 550


>gnl|LJGI|FS344049 homologue to UniRef100_Q9XIU5 Cluster: GmMYB29B2 protein; n=1;
           Glycine max|Rep: GmMYB29B2 protein - Glycine max
           (Soybean), partial (32%)
          Length = 703

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 106/132 (80%)
 Strand = Plus / Plus

                                                                       
Query: 97  catggccatggcaactggggaacacttccaaagcgtgccggtttgaataggtgcggcaag 156
           |||||||||||||||||| |  | ||||||||||  || || |||   ||||| || |||
Sbjct: 199 catggccatggcaactggcgtgcccttccaaagcaagcaggcttgttaaggtgtgggaag 258

                                                                       
Query: 157 agctgcaggctaaggtggactaactatctcaggccagatatcaagagaggcaaattcact 216
           |||||||| ||  | |||| ||||||| | ||||| |||||||||||||| || ||||| 
Sbjct: 259 agctgcagactgcgctggattaactatttgaggcctgatatcaagagagggaatttcaca 318

                       
Query: 217 gaagaagaggag 228
           |  |||||||||
Sbjct: 319 gccgaagaggag 330


>gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 protein; n=1;
           Glycine max|Rep: GmMYB29B2 protein - Glycine max
           (Soybean), partial (81%)
          Length = 1373

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 106/132 (80%)
 Strand = Plus / Plus

                                                                       
Query: 97  catggccatggcaactggggaacacttccaaagcgtgccggtttgaataggtgcggcaag 156
           |||||||||||||||||| |  | ||||||||||  || || |||   ||||| || |||
Sbjct: 232 catggccatggcaactggcgtgcccttccaaagcaagcaggcttgttaaggtgtgggaag 291

                                                                       
Query: 157 agctgcaggctaaggtggactaactatctcaggccagatatcaagagaggcaaattcact 216
           |||||||| ||  | |||| ||||||| | ||||| |||||||||||||| || ||||| 
Sbjct: 292 agctgcagactgcgctggattaactatttgaggcctgatatcaagagagggaatttcaca 351

                       
Query: 217 gaagaagaggag 228
           |  |||||||||
Sbjct: 352 gccgaagaggag 363


>gnl|LJGI|TC79087 homologue to UniRef100_Q0PJJ6 Cluster: MYB transcription factor
           MYB181; n=1; Glycine max|Rep: MYB transcription factor
           MYB181 - Glycine max (Soybean), partial (69%)
          Length = 532

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 286 catcttccaggaagaactgataatgagatcaagaatttctgga 328
           ||||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 354 catcttccagggagaactgacaatgagataaagaacttctgga 396