Miyakogusa Predicted Gene
- Lj2g3v1495100.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v1495100.1 Non Chatacterized Hit- tr|I1L4Y6|I1L4Y6_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,70.99,0,Homeodomain-like,Homeodomain-like;
Myb_DNA-binding,SANT/Myb domain; SANT SWI3, ADA2, N-CoR and
TFII,CUFF.37269.1
(1035 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|NP675421 GB|AB108650.1|BAC75673.1 transcription factor ... 131 1e-29
gnl|LJGI|TC82622 UniRef100_Q84PP5 Cluster: Transcription factor ... 115 6e-25
gnl|LJGI|TC76156 homologue to UniRef100_Q43525 Cluster: Transcri... 94 2e-18
gnl|LJGI|GO012149 similar to UniRef100_A7R2L2 Cluster: Chromosom... 76 5e-13
gnl|LJGI|TC69494 UniRef100_Q84PP4 Cluster: Transcription factor ... 72 8e-12
gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome... 70 3e-11
gnl|LJGI|TC70299 homologue to UniRef100_Q7X9I1 Cluster: MYB tran... 64 2e-09
gnl|LJGI|TC82778 similar to UniRef100_Q58QD0 Cluster: MYB5b; n=1... 62 7e-09
gnl|LJGI|TC68613 similar to UniRef100_Q9S7E3 Cluster: GmMYB29A1 ... 62 7e-09
gnl|LJGI|TC78802 similar to UniRef100_A7Q8B3 Cluster: Chromosome... 60 3e-08
gnl|LJGI|FS344049 homologue to UniRef100_Q9XIU5 Cluster: GmMYB29... 56 5e-07
gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 ... 56 5e-07
gnl|LJGI|TC79087 homologue to UniRef100_Q0PJJ6 Cluster: MYB tran... 54 2e-06
>gnl|LJGI|NP675421 GB|AB108650.1|BAC75673.1 transcription factor MYB103 [Lotus
japonicus]
Length = 924
Score = 131 bits (66), Expect = 1e-29
Identities = 162/194 (83%)
Strand = Plus / Plus
Query: 139 ttgaataggtgcggcaagagctgcaggctaaggtggactaactatctcaggccagatatc 198
||||| ||||| || ||||| |||||||||||||||||||| ||||| ||||| ||||||
Sbjct: 136 ttgaacaggtgtggaaagagttgcaggctaaggtggactaattatctgaggcctgatatc 195
Query: 199 aagagaggcaaattcactgaagaagaggagcgaatcatcatcaaccttcattcagttctt 258
||||| || |||||| |||| |||||||||| | |||||||||| || ||| || ||||
Sbjct: 196 aagagggggaaattctctgatgaagaggagcaactcatcatcaatctacatgcatctctt 255
Query: 259 ggaaacaagtggtcgaagattgcagcccatcttccaggaagaactgataatgagatcaag 318
|| || || ||| | | || ||| | ||||||||||| || |||||||||||||| |||
Sbjct: 256 ggcaataaatgggcaactatagcatctcatcttccagggaggactgataatgagattaag 315
Query: 319 aatttctggaacac 332
||||| ||||||||
Sbjct: 316 aatttatggaacac 329
>gnl|LJGI|TC82622 UniRef100_Q84PP5 Cluster: Transcription factor MYB101; n=1; Lotus
japonicus|Rep: Transcription factor MYB101 - Lotus
japonicus, partial (98%)
Length = 1068
Score = 115 bits (58), Expect = 6e-25
Identities = 175/214 (81%)
Strand = Plus / Plus
Query: 119 cacttccaaagcgtgccggtttgaataggtgcggcaagagctgcaggctaaggtggacta 178
||||||| |||| ||| || |||| |||||||| ||||| |||||||||||||||||||
Sbjct: 137 cacttccgaagcttgcaggactgaacaggtgcgggaagagttgcaggctaaggtggacta 196
Query: 179 actatctcaggccagatatcaagagaggcaaattcactgaagaagaggagcgaatcatca 238
|||| | ||||| ||||| || ||||| || |||||||| ||||| |||| | ||||||
Sbjct: 197 actacttgaggcctgatattaaaagaggaaagttcactgaggaagaagagcaactcatca 256
Query: 239 tcaaccttcattcagttcttggaaacaagtggtcgaagattgcagcccatcttccaggaa 298
|||| | ||| | |||||||| || |||||||| || |||| ||| | ||||| |
Sbjct: 257 tcaatttacatgctgttcttgggaataagtggtctgccatagcaggtcatttgccaggga 316
Query: 299 gaactgataatgagatcaagaatttctggaacac 332
| ||||||||||| ||||||||||||||||||||
Sbjct: 317 ggactgataatgaaatcaagaatttctggaacac 350
>gnl|LJGI|TC76156 homologue to UniRef100_Q43525 Cluster: Transcription factor; n=1;
Solanum lycopersicum|Rep: Transcription factor - Solanum
lycopersicum (Tomato) (Lycopersicon esculentum), partial
(61%)
Length = 1383
Score = 93.7 bits (47), Expect = 2e-18
Identities = 80/91 (87%)
Strand = Plus / Plus
Query: 292 ccaggaagaactgataatgagatcaagaatttctggaacactcacataaggaagaagctt 351
||||||||||| || |||||||| ||||||| ||||||||||||||| |||| |||||||
Sbjct: 562 ccaggaagaacagacaatgagataaagaattactggaacactcacatcaggaggaagctt 621
Query: 352 ctgaagatgggaattgaccctgaaactcaca 382
|||| | ||||||||||||| ||||||||
Sbjct: 622 ttgaacagaggaattgaccctgcaactcaca 652
>gnl|LJGI|GO012149 similar to UniRef100_A7R2L2 Cluster: Chromosome undetermined
scaffold_434, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_434,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (47%)
Length = 707
Score = 75.8 bits (38), Expect = 5e-13
Identities = 71/82 (86%)
Strand = Plus / Plus
Query: 292 ccaggaagaactgataatgagatcaagaatttctggaacactcacataaggaagaagctt 351
||||||||||| || ||||| |||||||| | |||||||||||||| || |||| ||||
Sbjct: 427 ccaggaagaacagacaatgaaatcaagaactattggaacactcacattagaaagaggctt 486
Query: 352 ctgaagatgggaattgaccctg 373
||||||||||| ||||| ||||
Sbjct: 487 ctgaagatgggtattgatcctg 508
>gnl|LJGI|TC69494 UniRef100_Q84PP4 Cluster: Transcription factor MYB102; n=1; Lotus
japonicus|Rep: Transcription factor MYB102 - Lotus
japonicus, complete
Length = 1245
Score = 71.9 bits (36), Expect = 8e-12
Identities = 69/80 (86%)
Strand = Plus / Plus
Query: 256 cttggaaacaagtggtcgaagattgcagcccatcttccaggaagaactgataatgagatc 315
||||||||||| ||||| |||||| | || ||||| ||||||||||| |||||||||
Sbjct: 284 cttggaaacaaatggtcagcaattgcaacacaccttccgggaagaactgacaatgagatc 343
Query: 316 aagaatttctggaacactca 335
|||||||| |||||||||||
Sbjct: 344 aagaatttttggaacactca 363
>gnl|LJGI|TC62535 similar to UniRef100_A7Q8B3 Cluster: Chromosome chr14 scaffold_63,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr14 scaffold_63, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (65%)
Length = 1350
Score = 69.9 bits (35), Expect = 3e-11
Identities = 80/95 (84%)
Strand = Plus / Plus
Query: 256 cttggaaacaagtggtcgaagattgcagcccatcttccaggaagaactgataatgagatc 315
|||||||||| ||||| |||||||| | ||||| || |||||||||||||||||||||
Sbjct: 404 cttggaaacagatggtctaagattgcttctcatctccctggaagaactgataatgagatc 463
Query: 316 aagaatttctggaacactcacataaggaagaagct 350
||||| |||||| || ||||||| ||| |||||
Sbjct: 464 aagaaccactggaatacccacataaagaaaaagct 498
>gnl|LJGI|TC70299 homologue to UniRef100_Q7X9I1 Cluster: MYB transcription factor
R2R3 type; n=1; Populus tremula x Populus
tremuloides|Rep: MYB transcription factor R2R3 type -
Populus tremula x Populus tremuloides, partial (64%)
Length = 1028
Score = 63.9 bits (32), Expect = 2e-09
Identities = 74/88 (84%)
Strand = Plus / Plus
Query: 295 ggaagaactgataatgagatcaagaatttctggaacactcacataaggaagaagcttctg 354
|||||||| || |||||||| ||||||| |||||||||||| ||||| | ||||||| ||
Sbjct: 426 ggaagaacagacaatgagataaagaattactggaacactcatataagaaggaagcttttg 485
Query: 355 aagatgggaattgaccctgaaactcaca 382
| | ||||||||||||| |||||||
Sbjct: 486 agcagaggaattgaccctgctactcaca 513
>gnl|LJGI|TC82778 similar to UniRef100_Q58QD0 Cluster: MYB5b; n=1; Vitis
vinifera|Rep: MYB5b - Vitis vinifera (Grape), partial
(23%)
Length = 957
Score = 61.9 bits (31), Expect = 7e-09
Identities = 40/43 (93%)
Strand = Plus / Plus
Query: 290 ttccaggaagaactgataatgagatcaagaatttctggaacac 332
|||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 177 ttccgggaagaactgataatgagataaagaacttctggaacac 219
>gnl|LJGI|TC68613 similar to UniRef100_Q9S7E3 Cluster: GmMYB29A1 protein; n=1;
Glycine max|Rep: GmMYB29A1 protein - Glycine max
(Soybean), partial (54%)
Length = 639
Score = 61.9 bits (31), Expect = 7e-09
Identities = 66/77 (85%), Gaps = 3/77 (3%)
Strand = Plus / Plus
Query: 154 aagagctgcaggctaaggtggactaactatctcaggccagatatcaagagaggcaaattc 213
||||||||||| ||| |||||| ||||||| | ||||| |||||||||||||| || |||
Sbjct: 256 aagagctgcagactacggtggattaactatttaaggcctgatatcaagagaggaaatttc 315
Query: 214 a---ctgaagaagagga 227
| |||||||||||||
Sbjct: 316 acagctgaagaagagga 332
>gnl|LJGI|TC78802 similar to UniRef100_A7Q8B3 Cluster: Chromosome chr14 scaffold_63,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr14 scaffold_63, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (56%)
Length = 1242
Score = 60.0 bits (30), Expect = 3e-08
Identities = 87/106 (82%)
Strand = Plus / Plus
Query: 268 tggtcgaagattgcagcccatcttccaggaagaactgataatgagatcaagaatttctgg 327
||||| ||||||||| | |||||||| |||||||| ||||||||||| || || |||
Sbjct: 445 tggtctaagattgcaactcatcttcctggaagaacagataatgagattaaaaaccattgg 504
Query: 328 aacactcacataaggaagaagcttctgaagatgggaattgaccctg 373
||||| ||||||| ||| ||||| ||| ||||||||||| ||||
Sbjct: 505 aacacccacataaagaaaaagctcaagaaaatgggaattgatcctg 550
>gnl|LJGI|FS344049 homologue to UniRef100_Q9XIU5 Cluster: GmMYB29B2 protein; n=1;
Glycine max|Rep: GmMYB29B2 protein - Glycine max
(Soybean), partial (32%)
Length = 703
Score = 56.0 bits (28), Expect = 5e-07
Identities = 106/132 (80%)
Strand = Plus / Plus
Query: 97 catggccatggcaactggggaacacttccaaagcgtgccggtttgaataggtgcggcaag 156
|||||||||||||||||| | | |||||||||| || || ||| ||||| || |||
Sbjct: 199 catggccatggcaactggcgtgcccttccaaagcaagcaggcttgttaaggtgtgggaag 258
Query: 157 agctgcaggctaaggtggactaactatctcaggccagatatcaagagaggcaaattcact 216
|||||||| || | |||| ||||||| | ||||| |||||||||||||| || |||||
Sbjct: 259 agctgcagactgcgctggattaactatttgaggcctgatatcaagagagggaatttcaca 318
Query: 217 gaagaagaggag 228
| |||||||||
Sbjct: 319 gccgaagaggag 330
>gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 protein; n=1;
Glycine max|Rep: GmMYB29B2 protein - Glycine max
(Soybean), partial (81%)
Length = 1373
Score = 56.0 bits (28), Expect = 5e-07
Identities = 106/132 (80%)
Strand = Plus / Plus
Query: 97 catggccatggcaactggggaacacttccaaagcgtgccggtttgaataggtgcggcaag 156
|||||||||||||||||| | | |||||||||| || || ||| ||||| || |||
Sbjct: 232 catggccatggcaactggcgtgcccttccaaagcaagcaggcttgttaaggtgtgggaag 291
Query: 157 agctgcaggctaaggtggactaactatctcaggccagatatcaagagaggcaaattcact 216
|||||||| || | |||| ||||||| | ||||| |||||||||||||| || |||||
Sbjct: 292 agctgcagactgcgctggattaactatttgaggcctgatatcaagagagggaatttcaca 351
Query: 217 gaagaagaggag 228
| |||||||||
Sbjct: 352 gccgaagaggag 363
>gnl|LJGI|TC79087 homologue to UniRef100_Q0PJJ6 Cluster: MYB transcription factor
MYB181; n=1; Glycine max|Rep: MYB transcription factor
MYB181 - Glycine max (Soybean), partial (69%)
Length = 532
Score = 54.0 bits (27), Expect = 2e-06
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 286 catcttccaggaagaactgataatgagatcaagaatttctgga 328
||||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 354 catcttccagggagaactgacaatgagataaagaacttctgga 396