Miyakogusa Predicted Gene
- Lj2g3v1415460.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v1415460.1 tr|Q748V7|Q748V7_GEOSL SEL1 repeat-containing
protein OS=Geobacter sulfurreducens (strain ATCC
51573,39.2,1e-18,HCP-like,NULL; F-box domain,F-box domain,
cyclin-like; FBOX,F-box domain, cyclin-like; SEL-1-LIKE
PR,CUFF.37022.1
(1005 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BW603505 weakly similar to UniRef100_Q94C27 Cluster: F-... 474 e-133
gnl|LJGI|BP070633 UniRef100_Q9EWF5 Cluster: Nitrate reductase de... 226 2e-58
gnl|LJGI|DC595229 167 2e-40
>gnl|LJGI|BW603505 weakly similar to UniRef100_Q94C27 Cluster: F-box protein
At1g70590; n=1; Arabidopsis thaliana|Rep: F-box protein
At1g70590 - Arabidopsis thaliana (Mouse-ear cress),
partial (26%)
Length = 487
Score = 474 bits (239), Expect = e-133
Identities = 239/239 (100%)
Strand = Plus / Plus
Query: 143 gaggcggcgatttctccgcgctcccgtacgatgtgctggcgaaggtcgcggcgtcgttcg 202
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 249 gaggcggcgatttctccgcgctcccgtacgatgtgctggcgaaggtcgcggcgtcgttcg 308
Query: 203 accagccgaacctccgggcggcgtcgctagtatgccgctcgtggcgggaggcgctgcagc 262
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 309 accagccgaacctccgggcggcgtcgctagtatgccgctcgtggcgggaggcgctgcagc 368
Query: 263 cgctgagggaggcgatggtgctcttgatgtgggggaagcggttcaagcacggccagcgag 322
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 369 cgctgagggaggcgatggtgctcttgatgtgggggaagcggttcaagcacggccagcgag 428
Query: 323 gtgtccgtccgaacatcgacaaggctctcgattcgttcatgaaagccgctgctcgtggc 381
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 429 gtgtccgtccgaacatcgacaaggctctcgattcgttcatgaaagccgctgctcgtggc 487
Score = 167 bits (84), Expect = 2e-40
Identities = 84/84 (100%)
Strand = Plus / Plus
Query: 1 atgaaggaccaccaccgaacttggcctcgtggctcctcttcctctcgtttctcttccctc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 107 atgaaggaccaccaccgaacttggcctcgtggctcctcttcctctcgtttctcttccctc 166
Query: 61 cccatcgcaaacctaaccgtcaat 84
||||||||||||||||||||||||
Sbjct: 167 cccatcgcaaacctaaccgtcaat 190
>gnl|LJGI|BP070633 UniRef100_Q9EWF5 Cluster: Nitrate reductase delta chain NarJ3; n=1;
Streptomyces coelicolor|Rep: Nitrate reductase delta
chain NarJ3 - Streptomyces coelicolor, partial (5%)
Length = 395
Score = 226 bits (114), Expect = 2e-58
Identities = 114/114 (100%)
Strand = Plus / Minus
Query: 892 gaaaagggtgcttctcatgtcaagaatgcagtagttcatcggctttcagcagcttcacgc 951
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 gaaaagggtgcttctcatgtcaagaatgcagtagttcatcggctttcagcagcttcacgc 336
Query: 952 gatcatgccatgcatctagctgacagttggcgtgctttgccctcaagttgatct 1005
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335 gatcatgccatgcatctagctgacagttggcgtgctttgccctcaagttgatct 282
>gnl|LJGI|DC595229
Length = 174
Score = 167 bits (84), Expect = 2e-40
Identities = 84/84 (100%)
Strand = Plus / Plus
Query: 1 atgaaggaccaccaccgaacttggcctcgtggctcctcttcctctcgtttctcttccctc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16 atgaaggaccaccaccgaacttggcctcgtggctcctcttcctctcgtttctcttccctc 75
Query: 61 cccatcgcaaacctaaccgtcaat 84
||||||||||||||||||||||||
Sbjct: 76 cccatcgcaaacctaaccgtcaat 99