Miyakogusa Predicted Gene

Lj2g3v1415460.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1415460.1 tr|Q748V7|Q748V7_GEOSL SEL1 repeat-containing
protein OS=Geobacter sulfurreducens (strain ATCC
51573,39.2,1e-18,HCP-like,NULL; F-box domain,F-box domain,
cyclin-like; FBOX,F-box domain, cyclin-like; SEL-1-LIKE
PR,CUFF.37022.1
         (1005 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW603505 weakly similar to UniRef100_Q94C27 Cluster: F-...   474   e-133
gnl|LJGI|BP070633 UniRef100_Q9EWF5 Cluster: Nitrate reductase de...   226   2e-58
gnl|LJGI|DC595229                                                     167   2e-40

>gnl|LJGI|BW603505 weakly similar to UniRef100_Q94C27 Cluster: F-box protein
           At1g70590; n=1; Arabidopsis thaliana|Rep: F-box protein
           At1g70590 - Arabidopsis thaliana (Mouse-ear cress),
           partial (26%)
          Length = 487

 Score =  474 bits (239), Expect = e-133
 Identities = 239/239 (100%)
 Strand = Plus / Plus

                                                                       
Query: 143 gaggcggcgatttctccgcgctcccgtacgatgtgctggcgaaggtcgcggcgtcgttcg 202
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 249 gaggcggcgatttctccgcgctcccgtacgatgtgctggcgaaggtcgcggcgtcgttcg 308

                                                                       
Query: 203 accagccgaacctccgggcggcgtcgctagtatgccgctcgtggcgggaggcgctgcagc 262
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 309 accagccgaacctccgggcggcgtcgctagtatgccgctcgtggcgggaggcgctgcagc 368

                                                                       
Query: 263 cgctgagggaggcgatggtgctcttgatgtgggggaagcggttcaagcacggccagcgag 322
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 369 cgctgagggaggcgatggtgctcttgatgtgggggaagcggttcaagcacggccagcgag 428

                                                                      
Query: 323 gtgtccgtccgaacatcgacaaggctctcgattcgttcatgaaagccgctgctcgtggc 381
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 429 gtgtccgtccgaacatcgacaaggctctcgattcgttcatgaaagccgctgctcgtggc 487



 Score =  167 bits (84), Expect = 2e-40
 Identities = 84/84 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaaggaccaccaccgaacttggcctcgtggctcctcttcctctcgtttctcttccctc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 107 atgaaggaccaccaccgaacttggcctcgtggctcctcttcctctcgtttctcttccctc 166

                                   
Query: 61  cccatcgcaaacctaaccgtcaat 84
           ||||||||||||||||||||||||
Sbjct: 167 cccatcgcaaacctaaccgtcaat 190


>gnl|LJGI|BP070633 UniRef100_Q9EWF5 Cluster: Nitrate reductase delta chain NarJ3; n=1;
            Streptomyces coelicolor|Rep: Nitrate reductase delta
            chain NarJ3 - Streptomyces coelicolor, partial (5%)
          Length = 395

 Score =  226 bits (114), Expect = 2e-58
 Identities = 114/114 (100%)
 Strand = Plus / Minus

                                                                        
Query: 892  gaaaagggtgcttctcatgtcaagaatgcagtagttcatcggctttcagcagcttcacgc 951
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395  gaaaagggtgcttctcatgtcaagaatgcagtagttcatcggctttcagcagcttcacgc 336

                                                                  
Query: 952  gatcatgccatgcatctagctgacagttggcgtgctttgccctcaagttgatct 1005
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335  gatcatgccatgcatctagctgacagttggcgtgctttgccctcaagttgatct 282


>gnl|LJGI|DC595229 
          Length = 174

 Score =  167 bits (84), Expect = 2e-40
 Identities = 84/84 (100%)
 Strand = Plus / Plus

                                                                      
Query: 1  atgaaggaccaccaccgaacttggcctcgtggctcctcttcctctcgtttctcttccctc 60
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16 atgaaggaccaccaccgaacttggcctcgtggctcctcttcctctcgtttctcttccctc 75

                                  
Query: 61 cccatcgcaaacctaaccgtcaat 84
          ||||||||||||||||||||||||
Sbjct: 76 cccatcgcaaacctaaccgtcaat 99