Miyakogusa Predicted Gene
- Lj2g3v1349500.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v1349500.1 Non Chatacterized Hit- tr|I1JBT7|I1JBT7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.56680 PE,75.86,0,no
description,Concanavalin A-like lectin/glucanase, subgroup; seg,NULL;
Galactoside-binding lectin,,CUFF.36813.1
(1020 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66494 similar to UniRef100_A7Q2N1 Cluster: Chromosome... 109 3e-23
>gnl|LJGI|TC66494 similar to UniRef100_A7Q2N1 Cluster: Chromosome chr1 scaffold_46,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr1 scaffold_46, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (62%)
Length = 1918
Score = 109 bits (55), Expect = 3e-23
Identities = 175/215 (81%)
Strand = Plus / Plus
Query: 535 aagatagcggtggtgagggatggagatgaagcggtgatggtgtcgcagttcatgttggag 594
||||| |||| |||||||||||| |||| ||| |||||| |||||||| || |||||
Sbjct: 694 aagattgcggcggtgagggatggggatgggccggcgatggtttcgcagtttgtggtggag 753
Query: 595 ttgcaggggttgaaggctgtggataaggaggagccgccaaggatactgcattttaatccg 654
||||||||||||||| | ||||| |||||| || || ||| | | || || || |||
Sbjct: 754 ttgcaggggttgaagacggtggagggggaggatcctccgagggtttttcacttcaacccg 813
Query: 655 aggttgaaaggggattggagtgggaagcctgtgattgagcaaaacacttgctataggatg 714
|||||||| || ||||||||||||||||| |||||||||| ||||| || || | |||
Sbjct: 814 aggttgaagggtgattggagtgggaagccggtgattgagctcaacacgtgttaccgtatg 873
Query: 715 cagtggggttctgctcttaggtgtgatgggtggaa 749
||||||||||| ||||| |||||||||| |||||
Sbjct: 874 cagtggggttcggctctccggtgtgatggttggaa 908