Miyakogusa Predicted Gene

Lj2g3v1292150.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1292150.1 CUFF.36698.1
         (301 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70398 similar to UniRef100_Q47TA8 Cluster: Phosphate:...    86   1e-16
gnl|LJGI|TC71180 weakly similar to UniRef100_A4RUA2 Cluster: Pre...    50   8e-06

>gnl|LJGI|TC70398 similar to UniRef100_Q47TA8 Cluster: Phosphate:acyl-[acyl carrier
           protein] acyltransferase; n=1; Thermobifida fusca
           YX|Rep: Phosphate:acyl-[acyl carrier protein]
           acyltransferase - Thermobifida fusca (strain YX),
           partial (5%)
          Length = 825

 Score = 85.7 bits (43), Expect = 1e-16
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                       
Query: 104 ggttacaggaaggttcttcaatggagaaattgcagatttgcagcactcaagggaggaaga 163
           |||| ||||||||| |  ||| ||||||| |||||| | ||| |  ||||||||||||||
Sbjct: 668 ggttgcaggaaggtgcgacaagggagaaaatgcagactcgcaaccttcaagggaggaaga 609

                                                                       
Query: 164 aggtgcaaccaatcgttttgccccaaatcagtgatttagggttcgattgggagagacggc 223
            |||  || ||| |||||| |||||||| | ||| ||||||||||||||| ||||| |||
Sbjct: 608 gggttgaatcaaccgttttcccccaaattactgaattagggttcgattggaagagaaggc 549

                                  
Query: 224 cgccgcggaaaccgccggattca 246
            |||||||||||| || ||||||
Sbjct: 548 agccgcggaaaccacctgattca 526


>gnl|LJGI|TC71180 weakly similar to UniRef100_A4RUA2 Cluster: Predicted protein; n=1;
            Ostreococcus lucimarinus CCE9901|Rep: Predicted protein -
            Ostreococcus lucimarinus (strain CCE9901), partial (17%)
          Length = 1653

 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 174  aatcgttttgccccaaatcagtgatttagggtt 206
            ||||||||| |||||||||||||||||| ||||
Sbjct: 1247 aatcgtttttccccaaatcagtgatttaaggtt 1279