Miyakogusa Predicted Gene
- Lj2g3v1277360.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v1277360.1 tr|G7IVG3|G7IVG3_MEDTR F-box/kelch-repeat protein
OS=Medicago truncatula GN=MTR_3g010620 PE=4
SV=1,55.36,0.000000001,F-box domain,F-box domain, cyclin-like;
F-box,F-box domain, cyclin-like; no description,NULL,CUFF.36750.1
(196 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|DC597111 similar to UniRef100_Q2HWB4 Cluster: Cyclin-li... 389 e-108
gnl|LJGI|TC58483 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik... 389 e-108
gnl|LJGI|DC593954 similar to UniRef100_Q2HWB4 Cluster: Cyclin-li... 145 1e-34
gnl|LJGI|TC77565 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik... 125 1e-28
gnl|LJGI|BW621082 similar to UniRef100_Q2HWB4 Cluster: Cyclin-li... 94 4e-19
gnl|LJGI|TC65255 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik... 72 1e-12
gnl|LJGI|AV423520 similar to UniRef100_Q2HWB4 Cluster: Cyclin-li... 62 1e-09
gnl|LJGI|TC76533 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik... 54 3e-07
gnl|LJGI|TC74128 similar to UniRef100_A7Q9Q9 Cluster: Chromosome... 52 1e-06
gnl|LJGI|TC82797 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik... 50 5e-06
>gnl|LJGI|DC597111 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (9%)
Length = 591
Score = 389 bits (196), Expect = e-108
Identities = 196/196 (100%)
Strand = Plus / Plus
Query: 1 atgtgcaggctccctgtgaagccggtgttgcgattccgctgcgtttgtaagtcgtggaaa 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 127 atgtgcaggctccctgtgaagccggtgttgcgattccgctgcgtttgtaagtcgtggaaa 186
Query: 61 tcactaatctctgatcccagattcgctaaaaagcacctccgctgttcgccgaagacggac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 187 tcactaatctctgatcccagattcgctaaaaagcacctccgctgttcgccgaagacggac 246
Query: 121 ttcacccgccatcacctcatcttacactacaacacctcctcacgccgccgccgcaaagat 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 247 ttcacccgccatcacctcatcttacactacaacacctcctcacgccgccgccgcaaagat 306
Query: 181 tacgttcacacggatt 196
||||||||||||||||
Sbjct: 307 tacgttcacacggatt 322
>gnl|LJGI|TC58483 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (12%)
Length = 786
Score = 389 bits (196), Expect = e-108
Identities = 196/196 (100%)
Strand = Plus / Plus
Query: 1 atgtgcaggctccctgtgaagccggtgttgcgattccgctgcgtttgtaagtcgtggaaa 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 174 atgtgcaggctccctgtgaagccggtgttgcgattccgctgcgtttgtaagtcgtggaaa 233
Query: 61 tcactaatctctgatcccagattcgctaaaaagcacctccgctgttcgccgaagacggac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 234 tcactaatctctgatcccagattcgctaaaaagcacctccgctgttcgccgaagacggac 293
Query: 121 ttcacccgccatcacctcatcttacactacaacacctcctcacgccgccgccgcaaagat 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 294 ttcacccgccatcacctcatcttacactacaacacctcctcacgccgccgccgcaaagat 353
Query: 181 tacgttcacacggatt 196
||||||||||||||||
Sbjct: 354 tacgttcacacggatt 369
>gnl|LJGI|DC593954 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (9%)
Length = 574
Score = 145 bits (73), Expect = 1e-34
Identities = 126/143 (88%), Gaps = 3/143 (2%)
Strand = Plus / Plus
Query: 2 tgtgcaggctccctgtgaagccggtgttgcgattccgctgcgtttgtaagtcgtggaaat 61
||||||||||||| ||||||||| || |||||||||||| |||||| ||||| ||||| |
Sbjct: 81 tgtgcaggctcccggtgaagccgctgctgcgattccgctccgtttgcaagtcctggaatt 140
Query: 62 cactaatctctgatcccagattcgctaaaaagcacctccgctgttcgccgaagacggact 121
| |||||||| ||||||| ||||| |||| |||||||||||||||||| ||||||||
Sbjct: 141 ccctaatctccgatcccatgttcgccaaaatgcacctccgctgttcgcc---gacggact 197
Query: 122 tcacccgccatcacctcatctta 144
|||||||||| ||||||||||||
Sbjct: 198 tcacccgccaccacctcatctta 220
>gnl|LJGI|TC77565 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (19%)
Length = 803
Score = 125 bits (63), Expect = 1e-28
Identities = 131/153 (85%), Gaps = 3/153 (1%)
Strand = Plus / Plus
Query: 4 tgcaggctccctgtgaagccggtgttgcgattccgctgcgtttgtaagtcgtggaaatca 63
||||||||||| ||||| || |||||| | ||||||||||||| ||||| ||||||||
Sbjct: 146 tgcaggctcccagtgaaatcgctgttgcaactccgctgcgtttgcaagtcctggaaatcg 205
Query: 64 ctaatctctgatcccagattcgctaaaaagcacctccgctgttcgccgaagacggacttc 123
|||||||| ||||||| |||||| ||||| ||||||||||||||| | ||||||||||
Sbjct: 206 ctaatctccgatcccaaattcgccaaaaaccacctccgctgttcgtc---gacggacttc 262
Query: 124 acccgccatcacctcatcttacactacaacacc 156
|||||||| | |||| ||||| ||||||||||
Sbjct: 263 acccgccaccgcctcttcttaagctacaacacc 295
>gnl|LJGI|BW621082 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (9%)
Length = 462
Score = 93.7 bits (47), Expect = 4e-19
Identities = 125/151 (82%)
Strand = Plus / Plus
Query: 4 tgcaggctccctgtgaagccggtgttgcgattccgctgcgtttgtaagtcgtggaaatca 63
||||||||| | ||||| || |||||| | ||||||||||||||||||| |||||| |
Sbjct: 106 tgcaggctctcggtgaaatcgctgttgcaactccgctgcgtttgtaagtcctggaaaacc 165
Query: 64 ctaatctctgatcccagattcgctaaaaagcacctccgctgttcgccgaagacggacttc 123
|||||||||||||||| |||||| ||| | ||||||| | | || | ||||||||||
Sbjct: 166 ctaatctctgatcccaaattcgccaaacaccacctcctccgctcttccccgacggacttc 225
Query: 124 acccgccatcacctcatcttacactacaaca 154
|||||||| | |||||||||| ||||||||
Sbjct: 226 acccgccaccgcctcatcttaggctacaaca 256
>gnl|LJGI|TC65255 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (8%)
Length = 703
Score = 71.9 bits (36), Expect = 1e-12
Identities = 69/80 (86%)
Strand = Plus / Plus
Query: 35 tccgctgcgtttgtaagtcgtggaaatcactaatctctgatcccagattcgctaaaaagc 94
|||||||||| || ||||| |||||| | |||||||| |||||| |||||| |||| ||
Sbjct: 220 tccgctgcgtatgcaagtcatggaaaaccctaatctccgatcccgaattcgccaaaacgc 279
Query: 95 acctccgctgttcgccgaag 114
||||||||||||| ||||||
Sbjct: 280 acctccgctgttcaccgaag 299
>gnl|LJGI|AV423520 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (15%)
Length = 468
Score = 61.9 bits (31), Expect = 1e-09
Identities = 116/143 (81%), Gaps = 6/143 (4%)
Strand = Plus / Plus
Query: 4 tgcaggctccctgtgaagccggtgttgcgattccgctgcgtttgtaagtcgtggaaatca 63
||||||||||| |||||| | | |||| |||||||||||| || ||||| ||||| ||
Sbjct: 195 tgcaggctccccgtgaagtccctcttgcaattccgctgcgtatgcaagtcctggaattct 254
Query: 64 ctaatctc---tgatcccagattcgctaaaaagcacctccgctgttcgccgaagacggac 120
|||||||| ||| |||| |||||| | ||| ||||| |||||||| || || ||||
Sbjct: 255 ctaatctccggtgaccccaaattcgccagaaaacaccttcgctgttcacctaa---ggac 311
Query: 121 ttcacccgccatcacctcatctt 143
||||| ||||| |||||||||||
Sbjct: 312 ttcacgcgccaccacctcatctt 334
>gnl|LJGI|TC76533 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (9%)
Length = 474
Score = 54.0 bits (27), Expect = 3e-07
Identities = 92/113 (81%), Gaps = 3/113 (2%)
Strand = Plus / Plus
Query: 28 ttgcgattccgctgcgtttgtaagtcgtggaaatcactaatctctgatcccagattcgct 87
|||| |||||||||||| || || || ||||| || || ||||| ||||||| ||| ||
Sbjct: 226 ttgcaattccgctgcgtatgcaaatcctggaattctctcatctccgatcccaaatttgcc 285
Query: 88 aaaaagcacctccgctgttcgccgaagacggacttcacccgccatcacctcat 140
||||| ||||||| ||||| || | |||||||||||||||| ||||||||
Sbjct: 286 aaaaaccacctccattgttcacc---gccggacttcacccgccaccacctcat 335
>gnl|LJGI|TC74128 similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5 scaffold_67,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr5 scaffold_67, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (9%)
Length = 501
Score = 52.0 bits (26), Expect = 1e-06
Identities = 59/70 (84%)
Strand = Plus / Plus
Query: 28 ttgcgattccgctgcgtttgtaagtcgtggaaatcactaatctctgatcccagattcgct 87
||||||||||| ||||| || ||||| ||||| || || || |||||||||| ||||||
Sbjct: 238 ttgcgattccggtgcgtctgcaagtcctggaattccctgatttctgatcccaaattcgcc 297
Query: 88 aaaaagcacc 97
| ||||||||
Sbjct: 298 agaaagcacc 307
>gnl|LJGI|TC82797 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (9%)
Length = 1418
Score = 50.1 bits (25), Expect = 5e-06
Identities = 61/73 (83%)
Strand = Plus / Plus
Query: 28 ttgcgattccgctgcgtttgtaagtcgtggaaatcactaatctctgatcccagattcgct 87
|||| |||||||||||| || || || |||||||| ||||||| ||||||| ||| ||
Sbjct: 247 ttgcaattccgctgcgtatgcaaatcctggaaatctttaatctccgatcccaaatttgcc 306
Query: 88 aaaaagcacctcc 100
||||| |||||||
Sbjct: 307 aaaaaacacctcc 319