Miyakogusa Predicted Gene
- Lj2g3v1253880.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v1253880.1 Non Chatacterized Hit- tr|D7LZ33|D7LZ33_ARALL
Putative uncharacterized protein OS=Arabidopsis
lyrata,32.38,0.00003,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
no description,NULL; S-adenosyl-L-methionine-depend,CUFF.36598.1
(777 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC64869 similar to UniRef100_Q3EC77 Cluster: Uncharacte... 210 1e-53
>gnl|LJGI|TC64869 similar to UniRef100_Q3EC77 Cluster: Uncharacterized protein
At2g03480.2; n=1; Arabidopsis thaliana|Rep:
Uncharacterized protein At2g03480.2 - Arabidopsis
thaliana (Mouse-ear cress), partial (32%)
Length = 1165
Score = 210 bits (106), Expect = 1e-53
Identities = 175/198 (88%)
Strand = Plus / Plus
Query: 1 atgctactagaagataatcaatttgcttttcagtcggaggatggactgatctatgatggt 60
||||| |||||||| |||||| |||| ||||| ||||||||||| |||||| ||| ||
Sbjct: 921 atgctgctagaagagaatcaaattgcctttcactcggaggatgggttgatctttgacgga 980
Query: 61 gtgaaagattattctcaccaaattgctgagatgatagggttgggaagtgacactgaattt 120
|||||||||||||||| ||| ||||||||||||||||||| |||||||||||||| |||
Sbjct: 981 gtgaaagattattctcgtcaacttgctgagatgatagggttaggaagtgacactgagttt 1040
Query: 121 cctcaggctggtgttcgcaccatactggacattaattgtggatttggtagctttggagct 180
| ||||||||||||||| || ||||| || ||||||||||||||||| ||||||||||||
Sbjct: 1041 catcaggctggtgttcgaactatactagatattaattgtggatttgggagctttggagct 1100
Query: 181 catttgttatccctgaaa 198
|||||||| || ||||||
Sbjct: 1101 catttgttgtcactgaaa 1118