Miyakogusa Predicted Gene

Lj2g3v1252820.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1252820.1 CUFF.36597.1
         (780 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66180 similar to UniRef100_A3RG89 Cluster: 14-3-3 pro...  1546   0.0  
gnl|LJGI|TC59299 homologue to UniRef100_A3RG89 Cluster: 14-3-3 p...   841   0.0  
gnl|LJGI|TC75094 homologue to UniRef100_O49152 Cluster: 14-3-3 p...    94   2e-18
gnl|LJGI|TC75963 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p...    82   6e-15
gnl|LJGI|TC72258 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p...    82   6e-15
gnl|LJGI|TC66817 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p...    82   6e-15
gnl|LJGI|TC58357 homologue to UniRef100_Q96450 Cluster: 14-3-3-l...    80   2e-14
gnl|LJGI|TC78948 homologue to UniRef100_Q9LKL0 Cluster: 14-3-3 p...    72   6e-12
gnl|LJGI|GO035957 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-...    70   2e-11
gnl|LJGI|TC69963 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3...    70   2e-11
gnl|LJGI|TC68574 homologue to UniRef100_Q93XW2 Cluster: 14-3-3 p...    70   2e-11
gnl|LJGI|TC82555 homologue to UniRef100_Q96450 Cluster: 14-3-3-l...    64   1e-09
gnl|LJGI|TC79634 homologue to UniRef100_A4RK75 Cluster: DNA dama...    60   2e-08
gnl|LJGI|TC80801 homologue to UniRef100_O49152 Cluster: 14-3-3 p...    58   9e-08
gnl|LJGI|TC72853 similar to UniRef100_Q9M5K7 Cluster: 14-3-3-lik...    58   9e-08

>gnl|LJGI|TC66180 similar to UniRef100_A3RG89 Cluster: 14-3-3 protein Lil 1433-2;
           n=1; Lilium longiflorum|Rep: 14-3-3 protein Lil 1433-2 -
           Lilium longiflorum (Trumpet lily), partial (98%)
          Length = 1252

 Score = 1546 bits (780), Expect = 0.0
 Identities = 780/780 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctgcggagaaagagagagagacccaggtttacttggccaagcttgctgaacaggcc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 82  atggctgcggagaaagagagagagacccaggtttacttggccaagcttgctgaacaggcc 141

                                                                       
Query: 61  gagagatatgaagaaatggtagaatgtatgaagaatgttgcaaaacttgatcttgagctt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 gagagatatgaagaaatggtagaatgtatgaagaatgttgcaaaacttgatcttgagctt 201

                                                                       
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtcattggtgcaaggaga 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 202 actgtggaagagaggaacctcctctcagtgggatataaaaatgtcattggtgcaaggaga 261

                                                                       
Query: 181 gcctcttggcgcattatgtcctcaatcgagcagaaggaagagactaagggaaatgagcac 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 262 gcctcttggcgcattatgtcctcaatcgagcagaaggaagagactaagggaaatgagcac 321

                                                                       
Query: 241 aatgttaagcagatcaagaattaccgccaaaaggttgaggaggaactctccaaaatttgt 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 322 aatgttaagcagatcaagaattaccgccaaaaggttgaggaggaactctccaaaatttgt 381

                                                                       
Query: 301 ggtgacatcctgactattatagaccagcatctaattccttcttccgcctcagcagaagct 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 382 ggtgacatcctgactattatagaccagcatctaattccttcttccgcctcagcagaagct 441

                                                                       
Query: 361 agtgttttctactataagatgaaaggtgattattatcggtatcttgctgagttcaagacc 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 442 agtgttttctactataagatgaaaggtgattattatcggtatcttgctgagttcaagacc 501

                                                                       
Query: 421 gaccaagaaaggaaagaggcagccgagcagtcactcaagggatatgaggctgcttcagcc 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 502 gaccaagaaaggaaagaggcagccgagcagtcactcaagggatatgaggctgcttcagcc 561

                                                                       
Query: 481 actgccaacaccgatcttccatcaacacatccaatccgtcttggacttgctctcaacttc 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 562 actgccaacaccgatcttccatcaacacatccaatccgtcttggacttgctctcaacttc 621

                                                                       
Query: 541 tctgtcttttattacgagatcatgaactctcctgaaagggcctgccatttggctaaacaa 600
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 622 tctgtcttttattacgagatcatgaactctcctgaaagggcctgccatttggctaaacaa 681

                                                                       
Query: 601 gcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagt 660
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 gcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagt 741

                                                                       
Query: 661 actttgatcatgcagttgttgagagacaacctgactctctggacatccgatttgccagaa 720
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 actttgatcatgcagttgttgagagacaacctgactctctggacatccgatttgccagaa 801

                                                                       
Query: 721 gatggaggcgaggagaacataaaagctgaagaagccaaacctactgagcctgagaattaa 780
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gatggaggcgaggagaacataaaagctgaagaagccaaacctactgagcctgagaattaa 861


>gnl|LJGI|TC59299 homologue to UniRef100_A3RG89 Cluster: 14-3-3 protein Lil 1433-2;
           n=1; Lilium longiflorum|Rep: 14-3-3 protein Lil 1433-2 -
           Lilium longiflorum (Trumpet lily), partial (94%)
          Length = 1181

 Score =  841 bits (424), Expect = 0.0
 Identities = 652/728 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctgcggagaaagagagagagacccaggtttacttggccaagcttgctgaacaggcc 60
           ||||| |||||||| ||||||||||| ||||||||| ||||||||||| |||| ||||| 
Sbjct: 82  atggccgcggagaaggagagagagacgcaggtttacatggccaagctttctgagcaggct 141

                                                                       
Query: 61  gagagatatgaagaaatggtagaatgtatgaagaatgttgcaaaacttgatcttgagctt 120
           || ||||||||||||||||| || || ||||||  ||| |||||||||||||||||||| 
Sbjct: 142 gaaagatatgaagaaatggttgagtgcatgaaggctgtagcaaaacttgatcttgagcta 201

                                                                       
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtcattggtgcaaggaga 180
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 202 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 261

                                                                       
Query: 181 gcctcttggcgcattatgtcctcaatcgagcagaaggaagagactaagggaaatgagcac 240
           ||||| |||||||||||||| || || || |||||||||||| | ||||||||||||  |
Sbjct: 262 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatgagagc 321

                                                                       
Query: 241 aatgttaagcagatcaagaattaccgccaaaaggttgaggaggaactctccaaaatttgt 300
           ||||| || | |||||||  |||| |||| || || ||||||||||| || || ||||| 
Sbjct: 322 aatgtgaaactgatcaagggttactgccacaaagtagaggaggaactgtctaagatttgc 381

                                                                       
Query: 301 ggtgacatcctgactattatagaccagcatctaattccttcttccgcctcagcagaagct 360
             |||||| ||||| ||||| ||||||||||| |||||||||||||| |||| |||||| 
Sbjct: 382 attgacattctgacaattatcgaccagcatctgattccttcttccgcttcaggagaagcc 441

                                                                       
Query: 361 agtgttttctactataagatgaaaggtgattattatcggtatcttgctgagttcaagacc 420
           |  ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 442 accgttttctactataagatgaaaggtgattattatcgttatcttgctgagttcaagacc 501

                                                                       
Query: 421 gaccaagaaaggaaagaggcagccgagcagtcactcaagggatatgaggctgcttcagcc 480
           |||||||| ||||| |||||||| ||||||||||| |||| |||||||||||||||||||
Sbjct: 502 gaccaagagaggaaggaggcagctgagcagtcactaaaggcatatgaggctgcttcagcc 561

                                                                       
Query: 481 actgccaacaccgatcttccatcaacacatccaatccgtcttggacttgctctcaacttc 540
           ||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 562 actgcaaacacagatcttccttcaacacatccaatccgtcttggacttgcactcaacttc 621

                                                                       
Query: 541 tctgtcttttattacgagatcatgaactctcctgaaagggcctgccatttggctaaacaa 600
           || ||||| ||||| ||||| |||||||| |||||||||||||| |||||||||||||||
Sbjct: 622 tcagtcttctattatgagataatgaactcacctgaaagggcctgtcatttggctaaacaa 681

                                                                       
Query: 601 gcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagt 660
           ||||| |||||||| ||||| ||||| |||||||||||||||||||||||||||||||| 
Sbjct: 682 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 741

                                                                       
Query: 661 actttgatcatgcagttgttgagagacaacctgactctctggacatccgatttgccagaa 720
           |||||||||||||||||||||||||||||||| ||||||||||| || ||||| || || 
Sbjct: 742 actttgatcatgcagttgttgagagacaaccttactctctggacctctgatttacctgag 801

                   
Query: 721 gatggagg 728
           ||||||||
Sbjct: 802 gatggagg 809


>gnl|LJGI|TC75094 homologue to UniRef100_O49152 Cluster: 14-3-3 protein homolog; n=1;
           Maackia amurensis|Rep: 14-3-3 protein homolog - Maackia
           amurensis, complete
          Length = 1280

 Score = 93.7 bits (47), Expect = 2e-18
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 508 catccaatccgtcttggacttgctctcaacttctctgtcttttattacgagatcatgaac 567
           ||||| |||||||| || || ||||| || ||||| || || ||||| |||||| |||| 
Sbjct: 594 catcccatccgtctgggcctggctctaaatttctcagttttctattatgagatcctgaat 653

                                                                       
Query: 568 tctcctgaaagggcctgccatttggctaaacaagcttttgatgaggcaattgcagagttg 627
           || |||||||| ||||| ||| | || || |||||||||||||| || ||| ||||| | 
Sbjct: 654 tcacctgaaagagcctgtcatcttgcaaagcaagcttttgatgaagctatttcagagctt 713

                                                          
Query: 628 gacaccttgagtgaagagtcatacaaggacagtactttgatcatgca 674
           || ||||||| ||||||||||||||| || || || |||||||||||
Sbjct: 714 gataccttgaatgaagagtcatacaaagatagcaccttgatcatgca 760



 Score = 81.8 bits (41), Expect = 6e-15
 Identities = 158/197 (80%)
 Strand = Plus / Plus

                                                                       
Query: 40  gccaagcttgctgaacaggccgagagatatgaagaaatggtagaatgtatgaagaatgtt 99
           ||||||||||| || ||||| ||| |||| ||||| ||||| || |  |||||||| |||
Sbjct: 126 gccaagcttgcagagcaggctgagcgatacgaagagatggtggattcgatgaagaaggtt 185

                                                                       
Query: 100 gcaaaacttgatcttgagcttactgtggaagagaggaacctcctctcagtgggatataaa 159
           || ||  | ||| |||| || ||||| |||||||||||  | || || ||||| ||||| 
Sbjct: 186 gcgaatttggatgttgaactgactgttgaagagaggaatttgctttctgtgggttataag 245

                                                                       
Query: 160 aatgtcattggtgcaaggagagcctcttggcgcattatgtcctcaatcgagcagaaggaa 219
           ||||| ||||||||  | ||||| || ||| | ||| |||| || || ||||||||||||
Sbjct: 246 aatgtgattggtgctcgcagagcgtcgtggaggattctgtcttccattgagcagaaggaa 305

                            
Query: 220 gagactaagggaaatga 236
           |||||||| ||||||||
Sbjct: 306 gagactaaaggaaatga 322



 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 370 tactataagatgaaaggtgattattatcggtatcttgc 407
           ||||||||||||||||| || |||||||| ||||||||
Sbjct: 456 tactataagatgaaaggagactattatcgttatcttgc 493


>gnl|LJGI|TC75963 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
           angularis|Rep: 14-3-3 protein - Phaseolus angularis
           (Adzuki bean) (Vigna angularis), complete
          Length = 1048

 Score = 81.8 bits (41), Expect = 6e-15
 Identities = 122/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 526 cttgctctcaacttctctgtcttttattacgagatcatgaactctcctgaaagggcctgc 585
           |||||||| ||||||||||| ||||| || |||||  |||||||||||||  | || |||
Sbjct: 704 cttgctctgaacttctctgtgttttactatgagattctgaactctcctgaccgagcttgc 763

                                                                       
Query: 586 catttggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagag 645
               | || ||||| |||||||||||||| ||||| || ||||| || ||| | || |||
Sbjct: 764 agccttgcaaaacaggcttttgatgaggccattgctgaattggatacattgggagaggag 823

                                        
Query: 646 tcatacaaggacagtactttgatcatgca 674
           ||||||||||| || ||||||||||||||
Sbjct: 824 tcatacaaggatagcactttgatcatgca 852


>gnl|LJGI|TC72258 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
           angularis|Rep: 14-3-3 protein - Phaseolus angularis
           (Adzuki bean) (Vigna angularis), complete
          Length = 1300

 Score = 81.8 bits (41), Expect = 6e-15
 Identities = 122/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 526 cttgctctcaacttctctgtcttttattacgagatcatgaactctcctgaaagggcctgc 585
           |||||||| || |||||||| ||||||||||||||  | |||||||||||  | ||||||
Sbjct: 669 cttgctctgaatttctctgtgttttattacgagattctcaactctcctgatcgtgcctgc 728

                                                                       
Query: 586 catttggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagag 645
            |  | || ||||| |||||||| || || ||||| || ||||| |||||| | || || 
Sbjct: 729 aacctcgcaaaacaggcttttgacgaagcgattgctgaattggataccttgggagaggaa 788

                                        
Query: 646 tcatacaaggacagtactttgatcatgca 674
           ||||||||||| || ||||||||||||||
Sbjct: 789 tcatacaaggatagcactttgatcatgca 817


>gnl|LJGI|TC66817 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
           angularis|Rep: 14-3-3 protein - Phaseolus angularis
           (Adzuki bean) (Vigna angularis), partial (61%)
          Length = 741

 Score = 81.8 bits (41), Expect = 6e-15
 Identities = 122/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 526 cttgctctcaacttctctgtcttttattacgagatcatgaactctcctgaaagggcctgc 585
           |||||||| ||||||||||| ||||| || |||||  |||||||||||||  | || |||
Sbjct: 233 cttgctctgaacttctctgtgttttactatgagattctgaactctcctgaccgagcttgc 292

                                                                       
Query: 586 catttggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagag 645
               | || ||||| |||||||||||||| ||||| || ||||| || ||| | || |||
Sbjct: 293 agccttgcaaaacaggcttttgatgaggccattgctgaattggatacattgggagaggag 352

                                        
Query: 646 tcatacaaggacagtactttgatcatgca 674
           ||||||||||| || ||||||||||||||
Sbjct: 353 tcatacaaggatagcactttgatcatgca 381


>gnl|LJGI|TC58357 homologue to UniRef100_Q96450 Cluster: 14-3-3-like protein A; n=1;
           Glycine max|Rep: 14-3-3-like protein A - Glycine max
           (Soybean), complete
          Length = 1153

 Score = 79.8 bits (40), Expect = 2e-14
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                       
Query: 604 tttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagtact 663
           ||||||||||| ||| | ||| | ||||| ||| ||||||||||||||||||||||||| 
Sbjct: 680 tttgatgaggcgatttctgagcttgacacattgggtgaagagtcatacaaggacagtaca 739

                       
Query: 664 ttgatcatgcag 675
           ||||||||||||
Sbjct: 740 ttgatcatgcag 751


>gnl|LJGI|TC78948 homologue to UniRef100_Q9LKL0 Cluster: 14-3-3 protein; n=1; Populus
           tremula x Populus alba|Rep: 14-3-3 protein - Populus
           tremula x Populus alba, partial (56%)
          Length = 633

 Score = 71.9 bits (36), Expect = 6e-12
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 604 tttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagtact 663
           ||||||||||| ||| | ||| | ||||| ||| |||||||||||||||||||| |||| 
Sbjct: 264 tttgatgaggcgatttctgagcttgacacattgggtgaagagtcatacaaggacggtaca 323

                       
Query: 664 ttgatcatgcag 675
           ||||||||||||
Sbjct: 324 ttgatcatgcag 335


>gnl|LJGI|GO035957 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3c protein; n=1;
           Vicia faba|Rep: Vf14-3-3c protein - Vicia faba (Broad
           bean), partial (80%)
          Length = 748

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 590 tggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcat 649
           |||||||||| || ||||| || |||||||| ||| ||||||||||| | ||||| || |
Sbjct: 580 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 639

                                                                  
Query: 650 acaaggacagtactttgatcatgcagttgttgagagacaacctgactctctggac 704
           |||| ||||| ||  | ||||||||| | || |||||||||||||| || |||||
Sbjct: 640 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggac 694


>gnl|LJGI|TC69963 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3c protein; n=1;
           Vicia faba|Rep: Vf14-3-3c protein - Vicia faba (Broad
           bean), partial (94%)
          Length = 1199

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 590 tggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcat 649
           |||||||||| || ||||| || |||||||| ||| ||||||||||| | ||||| || |
Sbjct: 827 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 886

                                                                  
Query: 650 acaaggacagtactttgatcatgcagttgttgagagacaacctgactctctggac 704
           |||| ||||| ||  | ||||||||| | || |||||||||||||| || |||||
Sbjct: 887 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggac 941


>gnl|LJGI|TC68574 homologue to UniRef100_Q93XW2 Cluster: 14-3-3 protein; n=1; Vigna
           angularis|Rep: 14-3-3 protein - Phaseolus angularis
           (Adzuki bean) (Vigna angularis), partial (42%)
          Length = 583

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 590 tggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcat 649
           |||||||||| || ||||| || |||||||| ||| ||||||||||| | ||||| || |
Sbjct: 168 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 227

                                                                  
Query: 650 acaaggacagtactttgatcatgcagttgttgagagacaacctgactctctggac 704
           |||| ||||| ||  | ||||||||| | || |||||||||||||| || |||||
Sbjct: 228 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggac 282


>gnl|LJGI|TC82555 homologue to UniRef100_Q96450 Cluster: 14-3-3-like protein A; n=1;
           Glycine max|Rep: 14-3-3-like protein A - Glycine max
           (Soybean), partial (78%)
          Length = 859

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 628 gacaccttgagtgaagagtcatacaaggacagtactttgatcatgcag 675
           ||||| ||| |||||| |||||||||||||||||| ||||||||||||
Sbjct: 606 gacacattgggtgaagggtcatacaaggacagtacattgatcatgcag 653


>gnl|LJGI|TC79634 homologue to UniRef100_A4RK75 Cluster: DNA damage checkpoint
           protein rad24; n=1; Magnaporthe grisea|Rep: DNA damage
           checkpoint protein rad24 - Magnaporthe grisea (Rice
           blast fungus) (Pyricularia grisea), partial (88%)
          Length = 1127

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 40  gccaagcttgctgaacaggccgagagatatgaagaaatggtagaatgtatgaag 93
           |||||||||||||| ||||| || ||||||||||| |||||||||  |||||||
Sbjct: 167 gccaagcttgctgagcaggctgaaagatatgaagagatggtagaaaatatgaag 220


>gnl|LJGI|TC80801 homologue to UniRef100_O49152 Cluster: 14-3-3 protein homolog; n=1;
           Maackia amurensis|Rep: 14-3-3 protein homolog - Maackia
           amurensis, partial (43%)
          Length = 489

 Score = 58.0 bits (29), Expect = 9e-08
 Identities = 155/197 (78%)
 Strand = Plus / Plus

                                                                       
Query: 40  gccaagcttgctgaacaggccgagagatatgaagaaatggtagaatgtatgaagaatgtt 99
           ||||||||||| || ||||| ||| ||||  |||| ||||| || |  ||||| || |||
Sbjct: 193 gccaagcttgcagagcaggctgagcgataccaagagatggtggattccatgaacaaggtt 252

                                                                       
Query: 100 gcaaaacttgatcttgagcttactgtggaagagaggaacctcctctcagtgggatataaa 159
           || ||  | ||| |||| || ||||| |||||||||||  | || || ||||| ||||| 
Sbjct: 253 gcgaatttggatgttgaactgactgttgaagagaggaatttgctttctgtgggttataag 312

                                                                       
Query: 160 aatgtcattggtgcaaggagagcctcttggcgcattatgtcctcaatcgagcagaaggaa 219
           ||||| ||||||||  | | ||| || ||| | ||| |||| || || ||||||||||||
Sbjct: 313 aatgtgattggtgctcgcacagcgtcctggaggattctgtcttccattgagcagaaggaa 372

                            
Query: 220 gagactaagggaaatga 236
           |||||||| ||||||||
Sbjct: 373 gagactaaaggaaatga 389


>gnl|LJGI|TC72853 similar to UniRef100_Q9M5K7 Cluster: 14-3-3-like protein; n=1;
           Glycine max|Rep: 14-3-3-like protein - Glycine max
           (Soybean), partial (32%)
          Length = 567

 Score = 58.0 bits (29), Expect = 9e-08
 Identities = 132/165 (80%), Gaps = 1/165 (0%)
 Strand = Plus / Plus

                                                                       
Query: 529 gctctcaacttctctgtcttttattacgagatcatgaactctcctgaaagggcctgccat 588
           ||||| || ||||| || |||||||| ||||| ||||| || |||| |||||||||||  
Sbjct: 47  gctctaaatttctccgtgttttattatgagataatgaattcacctgcaagggcctgccgc 106

                                                                       
Query: 589 ttggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagagtca 648
            | || || | ||| |||||||| ||  |  | ||| |||| ||| ||| |||||| || 
Sbjct: 107 cttgccaagccagcctttgatgatgccgtctcggagctggataccctgaatgaagattct 166

                                                        
Query: 649 tacaaggacagtact-ttgatcatgcagttgttgagagacaacct 692
           ||||||||||||||  |||||||||||| ||||| ||||||||||
Sbjct: 167 tacaaggacagtacccttgatcatgcagctgttgcgagacaacct 211