Miyakogusa Predicted Gene
- Lj2g3v1252820.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v1252820.1 CUFF.36597.1
(780 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66180 similar to UniRef100_A3RG89 Cluster: 14-3-3 pro... 1546 0.0
gnl|LJGI|TC59299 homologue to UniRef100_A3RG89 Cluster: 14-3-3 p... 841 0.0
gnl|LJGI|TC75094 homologue to UniRef100_O49152 Cluster: 14-3-3 p... 94 2e-18
gnl|LJGI|TC75963 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p... 82 6e-15
gnl|LJGI|TC72258 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p... 82 6e-15
gnl|LJGI|TC66817 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p... 82 6e-15
gnl|LJGI|TC58357 homologue to UniRef100_Q96450 Cluster: 14-3-3-l... 80 2e-14
gnl|LJGI|TC78948 homologue to UniRef100_Q9LKL0 Cluster: 14-3-3 p... 72 6e-12
gnl|LJGI|GO035957 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-... 70 2e-11
gnl|LJGI|TC69963 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3... 70 2e-11
gnl|LJGI|TC68574 homologue to UniRef100_Q93XW2 Cluster: 14-3-3 p... 70 2e-11
gnl|LJGI|TC82555 homologue to UniRef100_Q96450 Cluster: 14-3-3-l... 64 1e-09
gnl|LJGI|TC79634 homologue to UniRef100_A4RK75 Cluster: DNA dama... 60 2e-08
gnl|LJGI|TC80801 homologue to UniRef100_O49152 Cluster: 14-3-3 p... 58 9e-08
gnl|LJGI|TC72853 similar to UniRef100_Q9M5K7 Cluster: 14-3-3-lik... 58 9e-08
>gnl|LJGI|TC66180 similar to UniRef100_A3RG89 Cluster: 14-3-3 protein Lil 1433-2;
n=1; Lilium longiflorum|Rep: 14-3-3 protein Lil 1433-2 -
Lilium longiflorum (Trumpet lily), partial (98%)
Length = 1252
Score = 1546 bits (780), Expect = 0.0
Identities = 780/780 (100%)
Strand = Plus / Plus
Query: 1 atggctgcggagaaagagagagagacccaggtttacttggccaagcttgctgaacaggcc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 82 atggctgcggagaaagagagagagacccaggtttacttggccaagcttgctgaacaggcc 141
Query: 61 gagagatatgaagaaatggtagaatgtatgaagaatgttgcaaaacttgatcttgagctt 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 gagagatatgaagaaatggtagaatgtatgaagaatgttgcaaaacttgatcttgagctt 201
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtcattggtgcaaggaga 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 202 actgtggaagagaggaacctcctctcagtgggatataaaaatgtcattggtgcaaggaga 261
Query: 181 gcctcttggcgcattatgtcctcaatcgagcagaaggaagagactaagggaaatgagcac 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 262 gcctcttggcgcattatgtcctcaatcgagcagaaggaagagactaagggaaatgagcac 321
Query: 241 aatgttaagcagatcaagaattaccgccaaaaggttgaggaggaactctccaaaatttgt 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 322 aatgttaagcagatcaagaattaccgccaaaaggttgaggaggaactctccaaaatttgt 381
Query: 301 ggtgacatcctgactattatagaccagcatctaattccttcttccgcctcagcagaagct 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 382 ggtgacatcctgactattatagaccagcatctaattccttcttccgcctcagcagaagct 441
Query: 361 agtgttttctactataagatgaaaggtgattattatcggtatcttgctgagttcaagacc 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 442 agtgttttctactataagatgaaaggtgattattatcggtatcttgctgagttcaagacc 501
Query: 421 gaccaagaaaggaaagaggcagccgagcagtcactcaagggatatgaggctgcttcagcc 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 502 gaccaagaaaggaaagaggcagccgagcagtcactcaagggatatgaggctgcttcagcc 561
Query: 481 actgccaacaccgatcttccatcaacacatccaatccgtcttggacttgctctcaacttc 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 562 actgccaacaccgatcttccatcaacacatccaatccgtcttggacttgctctcaacttc 621
Query: 541 tctgtcttttattacgagatcatgaactctcctgaaagggcctgccatttggctaaacaa 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 622 tctgtcttttattacgagatcatgaactctcctgaaagggcctgccatttggctaaacaa 681
Query: 601 gcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagt 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 gcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagt 741
Query: 661 actttgatcatgcagttgttgagagacaacctgactctctggacatccgatttgccagaa 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 actttgatcatgcagttgttgagagacaacctgactctctggacatccgatttgccagaa 801
Query: 721 gatggaggcgaggagaacataaaagctgaagaagccaaacctactgagcctgagaattaa 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gatggaggcgaggagaacataaaagctgaagaagccaaacctactgagcctgagaattaa 861
>gnl|LJGI|TC59299 homologue to UniRef100_A3RG89 Cluster: 14-3-3 protein Lil 1433-2;
n=1; Lilium longiflorum|Rep: 14-3-3 protein Lil 1433-2 -
Lilium longiflorum (Trumpet lily), partial (94%)
Length = 1181
Score = 841 bits (424), Expect = 0.0
Identities = 652/728 (89%)
Strand = Plus / Plus
Query: 1 atggctgcggagaaagagagagagacccaggtttacttggccaagcttgctgaacaggcc 60
||||| |||||||| ||||||||||| ||||||||| ||||||||||| |||| |||||
Sbjct: 82 atggccgcggagaaggagagagagacgcaggtttacatggccaagctttctgagcaggct 141
Query: 61 gagagatatgaagaaatggtagaatgtatgaagaatgttgcaaaacttgatcttgagctt 120
|| ||||||||||||||||| || || |||||| ||| ||||||||||||||||||||
Sbjct: 142 gaaagatatgaagaaatggttgagtgcatgaaggctgtagcaaaacttgatcttgagcta 201
Query: 121 actgtggaagagaggaacctcctctcagtgggatataaaaatgtcattggtgcaaggaga 180
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 202 actgtggaagagaggaacctcctctcagtgggatataaaaatgtgattggtgcaaggaga 261
Query: 181 gcctcttggcgcattatgtcctcaatcgagcagaaggaagagactaagggaaatgagcac 240
||||| |||||||||||||| || || || |||||||||||| | |||||||||||| |
Sbjct: 262 gcctcgtggcgcattatgtcttcgattgaacagaaggaagagtcaaagggaaatgagagc 321
Query: 241 aatgttaagcagatcaagaattaccgccaaaaggttgaggaggaactctccaaaatttgt 300
||||| || | ||||||| |||| |||| || || ||||||||||| || || |||||
Sbjct: 322 aatgtgaaactgatcaagggttactgccacaaagtagaggaggaactgtctaagatttgc 381
Query: 301 ggtgacatcctgactattatagaccagcatctaattccttcttccgcctcagcagaagct 360
|||||| ||||| ||||| ||||||||||| |||||||||||||| |||| ||||||
Sbjct: 382 attgacattctgacaattatcgaccagcatctgattccttcttccgcttcaggagaagcc 441
Query: 361 agtgttttctactataagatgaaaggtgattattatcggtatcttgctgagttcaagacc 420
| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 442 accgttttctactataagatgaaaggtgattattatcgttatcttgctgagttcaagacc 501
Query: 421 gaccaagaaaggaaagaggcagccgagcagtcactcaagggatatgaggctgcttcagcc 480
|||||||| ||||| |||||||| ||||||||||| |||| |||||||||||||||||||
Sbjct: 502 gaccaagagaggaaggaggcagctgagcagtcactaaaggcatatgaggctgcttcagcc 561
Query: 481 actgccaacaccgatcttccatcaacacatccaatccgtcttggacttgctctcaacttc 540
||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 562 actgcaaacacagatcttccttcaacacatccaatccgtcttggacttgcactcaacttc 621
Query: 541 tctgtcttttattacgagatcatgaactctcctgaaagggcctgccatttggctaaacaa 600
|| ||||| ||||| ||||| |||||||| |||||||||||||| |||||||||||||||
Sbjct: 622 tcagtcttctattatgagataatgaactcacctgaaagggcctgtcatttggctaaacaa 681
Query: 601 gcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagt 660
||||| |||||||| ||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 682 gctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaaggacagc 741
Query: 661 actttgatcatgcagttgttgagagacaacctgactctctggacatccgatttgccagaa 720
|||||||||||||||||||||||||||||||| ||||||||||| || ||||| || ||
Sbjct: 742 actttgatcatgcagttgttgagagacaaccttactctctggacctctgatttacctgag 801
Query: 721 gatggagg 728
||||||||
Sbjct: 802 gatggagg 809
>gnl|LJGI|TC75094 homologue to UniRef100_O49152 Cluster: 14-3-3 protein homolog; n=1;
Maackia amurensis|Rep: 14-3-3 protein homolog - Maackia
amurensis, complete
Length = 1280
Score = 93.7 bits (47), Expect = 2e-18
Identities = 137/167 (82%)
Strand = Plus / Plus
Query: 508 catccaatccgtcttggacttgctctcaacttctctgtcttttattacgagatcatgaac 567
||||| |||||||| || || ||||| || ||||| || || ||||| |||||| ||||
Sbjct: 594 catcccatccgtctgggcctggctctaaatttctcagttttctattatgagatcctgaat 653
Query: 568 tctcctgaaagggcctgccatttggctaaacaagcttttgatgaggcaattgcagagttg 627
|| |||||||| ||||| ||| | || || |||||||||||||| || ||| ||||| |
Sbjct: 654 tcacctgaaagagcctgtcatcttgcaaagcaagcttttgatgaagctatttcagagctt 713
Query: 628 gacaccttgagtgaagagtcatacaaggacagtactttgatcatgca 674
|| ||||||| ||||||||||||||| || || || |||||||||||
Sbjct: 714 gataccttgaatgaagagtcatacaaagatagcaccttgatcatgca 760
Score = 81.8 bits (41), Expect = 6e-15
Identities = 158/197 (80%)
Strand = Plus / Plus
Query: 40 gccaagcttgctgaacaggccgagagatatgaagaaatggtagaatgtatgaagaatgtt 99
||||||||||| || ||||| ||| |||| ||||| ||||| || | |||||||| |||
Sbjct: 126 gccaagcttgcagagcaggctgagcgatacgaagagatggtggattcgatgaagaaggtt 185
Query: 100 gcaaaacttgatcttgagcttactgtggaagagaggaacctcctctcagtgggatataaa 159
|| || | ||| |||| || ||||| ||||||||||| | || || ||||| |||||
Sbjct: 186 gcgaatttggatgttgaactgactgttgaagagaggaatttgctttctgtgggttataag 245
Query: 160 aatgtcattggtgcaaggagagcctcttggcgcattatgtcctcaatcgagcagaaggaa 219
||||| |||||||| | ||||| || ||| | ||| |||| || || ||||||||||||
Sbjct: 246 aatgtgattggtgctcgcagagcgtcgtggaggattctgtcttccattgagcagaaggaa 305
Query: 220 gagactaagggaaatga 236
|||||||| ||||||||
Sbjct: 306 gagactaaaggaaatga 322
Score = 52.0 bits (26), Expect = 5e-06
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 370 tactataagatgaaaggtgattattatcggtatcttgc 407
||||||||||||||||| || |||||||| ||||||||
Sbjct: 456 tactataagatgaaaggagactattatcgttatcttgc 493
>gnl|LJGI|TC75963 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), complete
Length = 1048
Score = 81.8 bits (41), Expect = 6e-15
Identities = 122/149 (81%)
Strand = Plus / Plus
Query: 526 cttgctctcaacttctctgtcttttattacgagatcatgaactctcctgaaagggcctgc 585
|||||||| ||||||||||| ||||| || ||||| ||||||||||||| | || |||
Sbjct: 704 cttgctctgaacttctctgtgttttactatgagattctgaactctcctgaccgagcttgc 763
Query: 586 catttggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagag 645
| || ||||| |||||||||||||| ||||| || ||||| || ||| | || |||
Sbjct: 764 agccttgcaaaacaggcttttgatgaggccattgctgaattggatacattgggagaggag 823
Query: 646 tcatacaaggacagtactttgatcatgca 674
||||||||||| || ||||||||||||||
Sbjct: 824 tcatacaaggatagcactttgatcatgca 852
>gnl|LJGI|TC72258 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), complete
Length = 1300
Score = 81.8 bits (41), Expect = 6e-15
Identities = 122/149 (81%)
Strand = Plus / Plus
Query: 526 cttgctctcaacttctctgtcttttattacgagatcatgaactctcctgaaagggcctgc 585
|||||||| || |||||||| |||||||||||||| | ||||||||||| | ||||||
Sbjct: 669 cttgctctgaatttctctgtgttttattacgagattctcaactctcctgatcgtgcctgc 728
Query: 586 catttggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagag 645
| | || ||||| |||||||| || || ||||| || ||||| |||||| | || ||
Sbjct: 729 aacctcgcaaaacaggcttttgacgaagcgattgctgaattggataccttgggagaggaa 788
Query: 646 tcatacaaggacagtactttgatcatgca 674
||||||||||| || ||||||||||||||
Sbjct: 789 tcatacaaggatagcactttgatcatgca 817
>gnl|LJGI|TC66817 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), partial (61%)
Length = 741
Score = 81.8 bits (41), Expect = 6e-15
Identities = 122/149 (81%)
Strand = Plus / Plus
Query: 526 cttgctctcaacttctctgtcttttattacgagatcatgaactctcctgaaagggcctgc 585
|||||||| ||||||||||| ||||| || ||||| ||||||||||||| | || |||
Sbjct: 233 cttgctctgaacttctctgtgttttactatgagattctgaactctcctgaccgagcttgc 292
Query: 586 catttggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagag 645
| || ||||| |||||||||||||| ||||| || ||||| || ||| | || |||
Sbjct: 293 agccttgcaaaacaggcttttgatgaggccattgctgaattggatacattgggagaggag 352
Query: 646 tcatacaaggacagtactttgatcatgca 674
||||||||||| || ||||||||||||||
Sbjct: 353 tcatacaaggatagcactttgatcatgca 381
>gnl|LJGI|TC58357 homologue to UniRef100_Q96450 Cluster: 14-3-3-like protein A; n=1;
Glycine max|Rep: 14-3-3-like protein A - Glycine max
(Soybean), complete
Length = 1153
Score = 79.8 bits (40), Expect = 2e-14
Identities = 64/72 (88%)
Strand = Plus / Plus
Query: 604 tttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagtact 663
||||||||||| ||| | ||| | ||||| ||| |||||||||||||||||||||||||
Sbjct: 680 tttgatgaggcgatttctgagcttgacacattgggtgaagagtcatacaaggacagtaca 739
Query: 664 ttgatcatgcag 675
||||||||||||
Sbjct: 740 ttgatcatgcag 751
>gnl|LJGI|TC78948 homologue to UniRef100_Q9LKL0 Cluster: 14-3-3 protein; n=1; Populus
tremula x Populus alba|Rep: 14-3-3 protein - Populus
tremula x Populus alba, partial (56%)
Length = 633
Score = 71.9 bits (36), Expect = 6e-12
Identities = 63/72 (87%)
Strand = Plus / Plus
Query: 604 tttgatgaggcaattgcagagttggacaccttgagtgaagagtcatacaaggacagtact 663
||||||||||| ||| | ||| | ||||| ||| |||||||||||||||||||| ||||
Sbjct: 264 tttgatgaggcgatttctgagcttgacacattgggtgaagagtcatacaaggacggtaca 323
Query: 664 ttgatcatgcag 675
||||||||||||
Sbjct: 324 ttgatcatgcag 335
>gnl|LJGI|GO035957 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3c protein; n=1;
Vicia faba|Rep: Vf14-3-3c protein - Vicia faba (Broad
bean), partial (80%)
Length = 748
Score = 69.9 bits (35), Expect = 2e-11
Identities = 95/115 (82%)
Strand = Plus / Plus
Query: 590 tggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcat 649
|||||||||| || ||||| || |||||||| ||| ||||||||||| | ||||| || |
Sbjct: 580 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 639
Query: 650 acaaggacagtactttgatcatgcagttgttgagagacaacctgactctctggac 704
|||| ||||| || | ||||||||| | || |||||||||||||| || |||||
Sbjct: 640 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggac 694
>gnl|LJGI|TC69963 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3c protein; n=1;
Vicia faba|Rep: Vf14-3-3c protein - Vicia faba (Broad
bean), partial (94%)
Length = 1199
Score = 69.9 bits (35), Expect = 2e-11
Identities = 95/115 (82%)
Strand = Plus / Plus
Query: 590 tggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcat 649
|||||||||| || ||||| || |||||||| ||| ||||||||||| | ||||| || |
Sbjct: 827 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 886
Query: 650 acaaggacagtactttgatcatgcagttgttgagagacaacctgactctctggac 704
|||| ||||| || | ||||||||| | || |||||||||||||| || |||||
Sbjct: 887 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggac 941
>gnl|LJGI|TC68574 homologue to UniRef100_Q93XW2 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), partial (42%)
Length = 583
Score = 69.9 bits (35), Expect = 2e-11
Identities = 95/115 (82%)
Strand = Plus / Plus
Query: 590 tggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagagtcat 649
|||||||||| || ||||| || |||||||| ||| ||||||||||| | ||||| || |
Sbjct: 168 tggctaaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcct 227
Query: 650 acaaggacagtactttgatcatgcagttgttgagagacaacctgactctctggac 704
|||| ||||| || | ||||||||| | || |||||||||||||| || |||||
Sbjct: 228 acaaagacagcaccctcatcatgcagcttttaagagacaacctgaccctttggac 282
>gnl|LJGI|TC82555 homologue to UniRef100_Q96450 Cluster: 14-3-3-like protein A; n=1;
Glycine max|Rep: 14-3-3-like protein A - Glycine max
(Soybean), partial (78%)
Length = 859
Score = 63.9 bits (32), Expect = 1e-09
Identities = 44/48 (91%)
Strand = Plus / Plus
Query: 628 gacaccttgagtgaagagtcatacaaggacagtactttgatcatgcag 675
||||| ||| |||||| |||||||||||||||||| ||||||||||||
Sbjct: 606 gacacattgggtgaagggtcatacaaggacagtacattgatcatgcag 653
>gnl|LJGI|TC79634 homologue to UniRef100_A4RK75 Cluster: DNA damage checkpoint
protein rad24; n=1; Magnaporthe grisea|Rep: DNA damage
checkpoint protein rad24 - Magnaporthe grisea (Rice
blast fungus) (Pyricularia grisea), partial (88%)
Length = 1127
Score = 60.0 bits (30), Expect = 2e-08
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 40 gccaagcttgctgaacaggccgagagatatgaagaaatggtagaatgtatgaag 93
|||||||||||||| ||||| || ||||||||||| ||||||||| |||||||
Sbjct: 167 gccaagcttgctgagcaggctgaaagatatgaagagatggtagaaaatatgaag 220
>gnl|LJGI|TC80801 homologue to UniRef100_O49152 Cluster: 14-3-3 protein homolog; n=1;
Maackia amurensis|Rep: 14-3-3 protein homolog - Maackia
amurensis, partial (43%)
Length = 489
Score = 58.0 bits (29), Expect = 9e-08
Identities = 155/197 (78%)
Strand = Plus / Plus
Query: 40 gccaagcttgctgaacaggccgagagatatgaagaaatggtagaatgtatgaagaatgtt 99
||||||||||| || ||||| ||| |||| |||| ||||| || | ||||| || |||
Sbjct: 193 gccaagcttgcagagcaggctgagcgataccaagagatggtggattccatgaacaaggtt 252
Query: 100 gcaaaacttgatcttgagcttactgtggaagagaggaacctcctctcagtgggatataaa 159
|| || | ||| |||| || ||||| ||||||||||| | || || ||||| |||||
Sbjct: 253 gcgaatttggatgttgaactgactgttgaagagaggaatttgctttctgtgggttataag 312
Query: 160 aatgtcattggtgcaaggagagcctcttggcgcattatgtcctcaatcgagcagaaggaa 219
||||| |||||||| | | ||| || ||| | ||| |||| || || ||||||||||||
Sbjct: 313 aatgtgattggtgctcgcacagcgtcctggaggattctgtcttccattgagcagaaggaa 372
Query: 220 gagactaagggaaatga 236
|||||||| ||||||||
Sbjct: 373 gagactaaaggaaatga 389
>gnl|LJGI|TC72853 similar to UniRef100_Q9M5K7 Cluster: 14-3-3-like protein; n=1;
Glycine max|Rep: 14-3-3-like protein - Glycine max
(Soybean), partial (32%)
Length = 567
Score = 58.0 bits (29), Expect = 9e-08
Identities = 132/165 (80%), Gaps = 1/165 (0%)
Strand = Plus / Plus
Query: 529 gctctcaacttctctgtcttttattacgagatcatgaactctcctgaaagggcctgccat 588
||||| || ||||| || |||||||| ||||| ||||| || |||| |||||||||||
Sbjct: 47 gctctaaatttctccgtgttttattatgagataatgaattcacctgcaagggcctgccgc 106
Query: 589 ttggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagagtca 648
| || || | ||| |||||||| || | | ||| |||| ||| ||| |||||| ||
Sbjct: 107 cttgccaagccagcctttgatgatgccgtctcggagctggataccctgaatgaagattct 166
Query: 649 tacaaggacagtact-ttgatcatgcagttgttgagagacaacct 692
|||||||||||||| |||||||||||| ||||| ||||||||||
Sbjct: 167 tacaaggacagtacccttgatcatgcagctgttgcgagacaacct 211