Miyakogusa Predicted Gene

Lj2g3v1226730.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1226730.1 Non Chatacterized Hit- tr|I1JEJ1|I1JEJ1_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=3,74.08,0,seg,NULL; Protein kinase-like (PK-like),Protein
kinase-like domain; no description,NULL; PROTEIN_KIN,CUFF.36521.1
         (1544 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV769547                                                      66   7e-10
gnl|LJGI|BP042662 similar to UniRef100_Q94KF2 Cluster: Pto-like ...    56   7e-07

>gnl|LJGI|AV769547 
          Length = 416

 Score = 65.9 bits (33), Expect = 7e-10
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                 
Query: 1508 atgcaagtccattcgtaaatgctagcagggcttagat 1544
            |||||||||||||||||||||| ||||||||||||||
Sbjct: 416  atgcaagtccattcgtaaatgcaagcagggcttagat 380


>gnl|LJGI|BP042662 similar to UniRef100_Q94KF2 Cluster: Pto-like kinase SG5-3e; n=1;
            Phaseolus vulgaris|Rep: Pto-like kinase SG5-3e -
            Phaseolus vulgaris (Kidney bean) (French bean), partial
            (39%)
          Length = 484

 Score = 56.0 bits (28), Expect = 7e-07
 Identities = 94/116 (81%)
 Strand = Plus / Minus

                                                                        
Query: 1116 cacagaggttaaaggcacttttggatatttagaccctgagtactacaagaggaaaaaact 1175
            |||||| || |||||||||||||| ||| | || |||||||| | || |  | || | ||
Sbjct: 465  cacagatgtaaaaggcacttttgggtatcttgatcctgagtatttcaggtcgcaacagct 406

                                                                    
Query: 1176 gactcaaaaatctgatgtctattcatttggagtggttatgtttgaagtgctgtgtg 1231
            |||  ||||||||||||| ||||||||||| |||||| |  |||||||| ||||||
Sbjct: 405  gacggaaaaatctgatgtatattcatttggggtggttcttcttgaagtgttgtgtg 350