Miyakogusa Predicted Gene

Lj2g3v1203430.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1203430.1 tr|F6HGF2|F6HGF2_VITVI DNA-directed RNA
polymerase OS=Vitis vinifera GN=VIT_01s0010g00690 PE=3
SV=1,69.58,0,RNA_pol,DNA-directed RNA polymerase, phage-type;
seg,NULL; DNA/RNA polymerases,NULL; no description,,CUFF.36494.1
         (2973 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|CB826632 similar to UniRef100_A7PAG7 Cluster: DNA-direc...   367   e-100
gnl|LJGI|TC70388 similar to UniRef100_A7PAG7 Cluster: DNA-direct...   234   3e-60

>gnl|LJGI|CB826632 similar to UniRef100_A7PAG7 Cluster: DNA-directed RNA polymerase;
            n=1; Vitis vinifera|Rep: DNA-directed RNA polymerase -
            Vitis vinifera (Grape), partial (13%)
          Length = 520

 Score =  367 bits (185), Expect = e-100
 Identities = 356/413 (86%)
 Strand = Plus / Plus

                                                                        
Query: 2450 aagagatgtttgaggctgcaagaagtatcatgagttggcttgctgattgtgcaaaggtga 2509
            |||||||||||||||| ||||||||||| ||| ||||||| | |||||||||||||||||
Sbjct: 1    aagagatgtttgaggcagcaagaagtattatgggttggctaggtgattgtgcaaaggtga 60

                                                                        
Query: 2510 tagcttcaactaacgaaccagtgcggtggaccactcccattgggcttcctgcggtacaac 2569
            ||||||| || ||| || |||| || |||||||||||| ||||||||||||  |||||||
Sbjct: 61   tagcttccacaaaccaagcagtccgatggaccactccccttgggcttcctgtagtacaac 120

                                                                        
Query: 2570 cttacagacaaataggaagatctattataaaaacttcccttcaggtattgtcattgcgac 2629
            ||||  | |||   |||||   | |||| || |||||||||||||||||| | || |  |
Sbjct: 121  cttatcgccaacacggaaggcatcttatcaagacttcccttcaggtattgacgttacagc 180

                                                                        
Query: 2630 gggagactgacaaggtcttagttaaaaggcagagtactgctttccccccaaactttgttc 2689
            ||||||||||||||||| |   |||||| ||||| || |||||  ||||||| |||||||
Sbjct: 181  gggagactgacaaggtcatgactaaaagacagagaacagcttttgccccaaattttgttc 240

                                                                        
Query: 2690 actctcttgacggttctcacatgatgatgactgcagtcgcttgtaaaaaagcaggactgg 2749
            |||||||||| |||||||||||||||||||||||||| |||||||||||||||||  || 
Sbjct: 241  actctcttgatggttctcacatgatgatgactgcagttgcttgtaaaaaagcagggttga 300

                                                                        
Query: 2750 attttgcaggggtacatgattcatattggacacatgcatgtgatgttgatgaaatgaaca 2809
            | || |||||||| |||||||||||||||||||| || |||||||||||||||||||| |
Sbjct: 301  acttcgcaggggttcatgattcatattggacacacgcgtgtgatgttgatgaaatgaata 360

                                                                 
Query: 2810 ggatactaagggaaaagtttgttgaactctatgaggctccaatactggaaaat 2862
            || |||| ||||||||||||||||||||||| ||||||||| || ||||||||
Sbjct: 361  gggtactgagggaaaagtttgttgaactctacgaggctccagtattggaaaat 413


>gnl|LJGI|TC70388 similar to UniRef100_A7PAG7 Cluster: DNA-directed RNA polymerase;
            n=1; Vitis vinifera|Rep: DNA-directed RNA polymerase -
            Vitis vinifera (Grape), partial (22%)
          Length = 1297

 Score =  234 bits (118), Expect = 3e-60
 Identities = 400/494 (80%)
 Strand = Plus / Plus

                                                                        
Query: 2440 actgccttagaagagatgtttgaggctgcaagaagtatcatgagttggcttgctgattgt 2499
            ||||||||||| ||||||||| | |  ||| |||||||||||| |||||||| ||| |||
Sbjct: 166  actgccttagaggagatgtttcaaggggcacgaagtatcatgaattggcttggtgaatgt 225

                                                                        
Query: 2500 gcaaaggtgatagcttcaactaacgaaccagtgcggtggaccactcccattgggcttcct 2559
            ||||| || || || ||    ||  |||| ||||| |||||||||||  |||| ||||||
Sbjct: 226  gcaaaagtaattgcatctgaaaatcaaccggtgcgctggaccactcctcttggacttcct 285

                                                                        
Query: 2560 gcggtacaaccttacagacaaataggaagatctattataaaaacttcccttcaggtattg 2619
            | ||| ||||||||| |  || | |||||    ||||| |||||||| |||||| | |||
Sbjct: 286  gtggtgcaaccttaccgtaaacttggaaggcacattatcaaaacttcacttcagatgttg 345

                                                                        
Query: 2620 tcattgcgacgggagactgacaaggtcttagttaaaaggcagagtactgctttcccccca 2679
             |||| | ||| || || ||||||||| | || ||  ||||||| || || || || |||
Sbjct: 346  acattacaacgagaaacagacaaggtcatggtcaagcggcagaggacagcatttccgcca 405

                                                                        
Query: 2680 aactttgttcactctcttgacggttctcacatgatgatgactgcagtcgcttgtaaaaaa 2739
            || ||||||||||| ||||| |||||||| ||||||||||||||||| || || ||| ||
Sbjct: 406  aattttgttcactcacttgatggttctcatatgatgatgactgcagttgcctgcaaacaa 465

                                                                        
Query: 2740 gcaggactggattttgcaggggtacatgattcatattggacacatgcatgtgatgttgat 2799
            |||||  ||| |||||| ||||| ||||||||||||||||| ||||| |||||||| |||
Sbjct: 466  gcaggcttggcttttgccggggtccatgattcatattggacgcatgcgtgtgatgtggat 525

                                                                        
Query: 2800 gaaatgaacaggatactaagggaaaagtttgttgaactctatgaggctccaatactggaa 2859
            || |||||||| ||||| || |  || ||||| |||||||||||| | ||||||||||||
Sbjct: 526  gatatgaacagaatactgagagggaaatttgtagaactctatgagaccccaatactggaa 585

                                                                        
Query: 2860 aatttgttggagagctttcagaagtcttttcccaagttgaactttcctcccttaccagag 2919
            ||||| |||||| |||||||||||||||| ||    |||   ||||| ||||| || |||
Sbjct: 586  aatttattggagggctttcagaagtctttcccatcattgtcatttccacccttgcctgag 645

                          
Query: 2920 cggggagacttcga 2933
            ||||||||||||||
Sbjct: 646  cggggagacttcga 659