Miyakogusa Predicted Gene
- Lj2g3v1203430.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v1203430.1 tr|F6HGF2|F6HGF2_VITVI DNA-directed RNA
polymerase OS=Vitis vinifera GN=VIT_01s0010g00690 PE=3
SV=1,69.58,0,RNA_pol,DNA-directed RNA polymerase, phage-type;
seg,NULL; DNA/RNA polymerases,NULL; no description,,CUFF.36494.1
(2973 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|CB826632 similar to UniRef100_A7PAG7 Cluster: DNA-direc... 367 e-100
gnl|LJGI|TC70388 similar to UniRef100_A7PAG7 Cluster: DNA-direct... 234 3e-60
>gnl|LJGI|CB826632 similar to UniRef100_A7PAG7 Cluster: DNA-directed RNA polymerase;
n=1; Vitis vinifera|Rep: DNA-directed RNA polymerase -
Vitis vinifera (Grape), partial (13%)
Length = 520
Score = 367 bits (185), Expect = e-100
Identities = 356/413 (86%)
Strand = Plus / Plus
Query: 2450 aagagatgtttgaggctgcaagaagtatcatgagttggcttgctgattgtgcaaaggtga 2509
|||||||||||||||| ||||||||||| ||| ||||||| | |||||||||||||||||
Sbjct: 1 aagagatgtttgaggcagcaagaagtattatgggttggctaggtgattgtgcaaaggtga 60
Query: 2510 tagcttcaactaacgaaccagtgcggtggaccactcccattgggcttcctgcggtacaac 2569
||||||| || ||| || |||| || |||||||||||| |||||||||||| |||||||
Sbjct: 61 tagcttccacaaaccaagcagtccgatggaccactccccttgggcttcctgtagtacaac 120
Query: 2570 cttacagacaaataggaagatctattataaaaacttcccttcaggtattgtcattgcgac 2629
|||| | ||| ||||| | |||| || |||||||||||||||||| | || | |
Sbjct: 121 cttatcgccaacacggaaggcatcttatcaagacttcccttcaggtattgacgttacagc 180
Query: 2630 gggagactgacaaggtcttagttaaaaggcagagtactgctttccccccaaactttgttc 2689
||||||||||||||||| | |||||| ||||| || ||||| ||||||| |||||||
Sbjct: 181 gggagactgacaaggtcatgactaaaagacagagaacagcttttgccccaaattttgttc 240
Query: 2690 actctcttgacggttctcacatgatgatgactgcagtcgcttgtaaaaaagcaggactgg 2749
|||||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||
Sbjct: 241 actctcttgatggttctcacatgatgatgactgcagttgcttgtaaaaaagcagggttga 300
Query: 2750 attttgcaggggtacatgattcatattggacacatgcatgtgatgttgatgaaatgaaca 2809
| || |||||||| |||||||||||||||||||| || |||||||||||||||||||| |
Sbjct: 301 acttcgcaggggttcatgattcatattggacacacgcgtgtgatgttgatgaaatgaata 360
Query: 2810 ggatactaagggaaaagtttgttgaactctatgaggctccaatactggaaaat 2862
|| |||| ||||||||||||||||||||||| ||||||||| || ||||||||
Sbjct: 361 gggtactgagggaaaagtttgttgaactctacgaggctccagtattggaaaat 413
>gnl|LJGI|TC70388 similar to UniRef100_A7PAG7 Cluster: DNA-directed RNA polymerase;
n=1; Vitis vinifera|Rep: DNA-directed RNA polymerase -
Vitis vinifera (Grape), partial (22%)
Length = 1297
Score = 234 bits (118), Expect = 3e-60
Identities = 400/494 (80%)
Strand = Plus / Plus
Query: 2440 actgccttagaagagatgtttgaggctgcaagaagtatcatgagttggcttgctgattgt 2499
||||||||||| ||||||||| | | ||| |||||||||||| |||||||| ||| |||
Sbjct: 166 actgccttagaggagatgtttcaaggggcacgaagtatcatgaattggcttggtgaatgt 225
Query: 2500 gcaaaggtgatagcttcaactaacgaaccagtgcggtggaccactcccattgggcttcct 2559
||||| || || || || || |||| ||||| ||||||||||| |||| ||||||
Sbjct: 226 gcaaaagtaattgcatctgaaaatcaaccggtgcgctggaccactcctcttggacttcct 285
Query: 2560 gcggtacaaccttacagacaaataggaagatctattataaaaacttcccttcaggtattg 2619
| ||| ||||||||| | || | ||||| ||||| |||||||| |||||| | |||
Sbjct: 286 gtggtgcaaccttaccgtaaacttggaaggcacattatcaaaacttcacttcagatgttg 345
Query: 2620 tcattgcgacgggagactgacaaggtcttagttaaaaggcagagtactgctttcccccca 2679
|||| | ||| || || ||||||||| | || || ||||||| || || || || |||
Sbjct: 346 acattacaacgagaaacagacaaggtcatggtcaagcggcagaggacagcatttccgcca 405
Query: 2680 aactttgttcactctcttgacggttctcacatgatgatgactgcagtcgcttgtaaaaaa 2739
|| ||||||||||| ||||| |||||||| ||||||||||||||||| || || ||| ||
Sbjct: 406 aattttgttcactcacttgatggttctcatatgatgatgactgcagttgcctgcaaacaa 465
Query: 2740 gcaggactggattttgcaggggtacatgattcatattggacacatgcatgtgatgttgat 2799
||||| ||| |||||| ||||| ||||||||||||||||| ||||| |||||||| |||
Sbjct: 466 gcaggcttggcttttgccggggtccatgattcatattggacgcatgcgtgtgatgtggat 525
Query: 2800 gaaatgaacaggatactaagggaaaagtttgttgaactctatgaggctccaatactggaa 2859
|| |||||||| ||||| || | || ||||| |||||||||||| | ||||||||||||
Sbjct: 526 gatatgaacagaatactgagagggaaatttgtagaactctatgagaccccaatactggaa 585
Query: 2860 aatttgttggagagctttcagaagtcttttcccaagttgaactttcctcccttaccagag 2919
||||| |||||| |||||||||||||||| || ||| ||||| ||||| || |||
Sbjct: 586 aatttattggagggctttcagaagtctttcccatcattgtcatttccacccttgcctgag 645
Query: 2920 cggggagacttcga 2933
||||||||||||||
Sbjct: 646 cggggagacttcga 659