Miyakogusa Predicted Gene

Lj2g3v1172400.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1172400.1 Non Chatacterized Hit- tr|I1JDX0|I1JDX0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.231
PE=3,85.93,0,PROTEIN_KINASE_ATP,Protein kinase, ATP binding site;
PROTEIN_KINASE_ST,Serine/threonine-protein kina,CUFF.36360.1
         (1737 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78016                                                      103   4e-21

>gnl|LJGI|TC78016 
          Length = 901

 Score =  103 bits (52), Expect = 4e-21
 Identities = 68/72 (94%), Gaps = 1/72 (1%)
 Strand = Plus / Plus

                                                                       
Query: 656 agaaggctgctgaatactggctcatatggcggtttgaaggggattccaccttagctgatc 715
           ||||||||||||||||||||||||||||| |||||||||||||||||| |||||| ||||
Sbjct: 466 agaaggctgctgaatactggctcatatggtggtttgaaggggattccaacttagc-gatc 524

                       
Query: 716 tgatacagagta 727
           |||| |||||||
Sbjct: 525 tgatgcagagta 536