Miyakogusa Predicted Gene
- Lj2g3v1172400.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v1172400.1 Non Chatacterized Hit- tr|I1JDX0|I1JDX0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.231
PE=3,85.93,0,PROTEIN_KINASE_ATP,Protein kinase, ATP binding site;
PROTEIN_KINASE_ST,Serine/threonine-protein kina,CUFF.36360.1
(1737 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC78016 103 4e-21
>gnl|LJGI|TC78016
Length = 901
Score = 103 bits (52), Expect = 4e-21
Identities = 68/72 (94%), Gaps = 1/72 (1%)
Strand = Plus / Plus
Query: 656 agaaggctgctgaatactggctcatatggcggtttgaaggggattccaccttagctgatc 715
||||||||||||||||||||||||||||| |||||||||||||||||| |||||| ||||
Sbjct: 466 agaaggctgctgaatactggctcatatggtggtttgaaggggattccaacttagc-gatc 524
Query: 716 tgatacagagta 727
|||| |||||||
Sbjct: 525 tgatgcagagta 536