Miyakogusa Predicted Gene
- Lj2g3v1105310.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v1105310.1 Non Chatacterized Hit- tr|I3SZR4|I3SZR4_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2
SV=1,72.73,0,COBRA,Glycosyl-phosphatidyl inositol-anchored, plant;
seg,NULL; Q69F98_PHAVU_Q69F98;,Glycosyl-phosph,CUFF.36252.1
(762 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS340199 similar to UniRef100_Q69F98 Cluster: Phytochel... 206 1e-52
gnl|LJGI|GO026464 similar to UniRef100_Q69F98 Cluster: Phytochel... 66 3e-10
>gnl|LJGI|FS340199 similar to UniRef100_Q69F98 Cluster: Phytochelatin synthetase-like
protein; n=1; Phaseolus vulgaris|Rep: Phytochelatin
synthetase-like protein - Phaseolus vulgaris (Kidney
bean) (French bean), partial (22%)
Length = 468
Score = 206 bits (104), Expect = 1e-52
Identities = 221/260 (85%)
Strand = Plus / Plus
Query: 64 tcatcagaagcttatgatcctcttgacccaaacggaaacatcacaataagatgggatata 123
|||||||||||||||||||| ||||||||| | |||||||||||||| | ||||||| |
Sbjct: 209 tcatcagaagcttatgatccacttgacccatatggaaacatcacaatcaaatgggatgtt 268
Query: 124 ctaagctggacaggggatggttatgttgctgcggtaacattaaacaacttccagcaatat 183
|||||||||||| ||||||||| ||||| || ||| | |||||||||| ||||||
Sbjct: 269 aaaagctggacaggtgatggttatcttgctattgttacaatttacaacttccaacaatat 328
Query: 184 agacatatccaagaacctgggtggtcactaggatggacgtgggcaaagaatgagataatc 243
| |||||| || |||||||||||||||||||||||| ||||||||||| ||| ||||
Sbjct: 329 cgtcatatctcagcacctgggtggtcactaggatggacatgggcaaagaaggaggtaata 388
Query: 244 tggcaaatgataggagggcaaaccaccgagcaaggagactgctcaaaatttaagggacaa 303
||| | ||||| |||||||| ||||||||||||||||| || ||||||||||||||| ||
Sbjct: 389 tggaacatgatgggagggcagaccaccgagcaaggagattgttcaaaatttaagggagaa 448
Query: 304 gtgtccccacattgctgcaa 323
| |||||||||||||||
Sbjct: 449 cagatcccacattgctgcaa 468
>gnl|LJGI|GO026464 similar to UniRef100_Q69F98 Cluster: Phytochelatin synthetase-like
protein; n=1; Phaseolus vulgaris|Rep: Phytochelatin
synthetase-like protein - Phaseolus vulgaris (Kidney
bean) (French bean), partial (38%)
Length = 578
Score = 65.9 bits (33), Expect = 3e-10
Identities = 183/233 (78%)
Strand = Plus / Plus
Query: 68 cagaagcttatgatcctcttgacccaaacggaaacatcacaataagatgggatatactaa 127
|||| ||||||||||| ||||| || || || || |||||||| | ||||||||| |||
Sbjct: 109 cagatgcttatgatccgcttgatcctaatgggaatatcacaatcaaatgggatattataa 168
Query: 128 gctggacaggggatggttatgttgctgcggtaacattaaacaacttccagcaatatagac 187
||||||| |||||||||||||| | || ||| | ||||||||||| |||||| | |
Sbjct: 169 cctggacatcagatggttatgttgcggttgttacaatgaacaacttccaacaatatcgtc 228
Query: 188 atatccaagaacctgggtggtcactaggatggacgtgggcaaagaatgagataatctggc 247
||||| | |||||| |||||| |||||||| | ||||| || || ||| |||| |||
Sbjct: 229 atatcgctgcacctggctggtcattaggatgggcatgggccaaaaaggaggtaatatgga 288
Query: 248 aaatgataggagggcaaaccaccgagcaaggagactgctcaaaatttaaggga 300
||| | || ||||| |||| || ||||| || || |||||||||||||||
Sbjct: 289 gcatggtgggggggcaggccactgaacaaggggattgttcaaaatttaaggga 341