Miyakogusa Predicted Gene

Lj2g3v1102960.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1102960.1 Non Chatacterized Hit- tr|I1NFM3|I1NFM3_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=3,67.94,0,Serine/Threonine protein kinases,
catalytic,Serine/threonine- / dual-specificity protein kinase,
cat,CUFF.36228.1
         (991 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC65552 similar to UniRef100_A7PGX2 Cluster: Chromosome...    68   1e-10
gnl|LJGI|TC72348 UniRef100_Q53VE0 Cluster: Ser/Thr protein kinas...    64   2e-09

>gnl|LJGI|TC65552 similar to UniRef100_A7PGX2 Cluster: Chromosome chr17 scaffold_16,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr17 scaffold_16, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (28%)
          Length = 720

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                       
Query: 742 agaggaactgcagggtatattgctcctgaggtattttcaaggaattttggtgtggtgtct 801
           ||||||||||| ||||| ||||| || ||||| ||||| || || |||||||  || || 
Sbjct: 162 agaggaactgcggggtacattgccccggaggtgttttctagaaactttggtgcagtatca 221

                                                             
Query: 802 cacaagtccgatgtttatagttttggaatgatggttctagaaatggttgg 851
           |||||||| ||||||||||| |  |||||||||||  ||||||| |||||
Sbjct: 222 cacaagtcagatgtttatagctacggaatgatggtcttagaaattgttgg 271


>gnl|LJGI|TC72348 UniRef100_Q53VE0 Cluster: Ser/Thr protein kinase; n=1; Lotus
            japonicus|Rep: Ser/Thr protein kinase - Lotus japonicus,
            complete
          Length = 2250

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 113/138 (81%), Gaps = 4/138 (2%)
 Strand = Plus / Plus

                                                                        
Query: 722  ttgtgtctatgttggaagcaagaggaactgcagggtatattgctcctgaggtattt--tc 779
            ||||||||||||||| | ||||||||||| | ||||| ||||| || || ||||||  ||
Sbjct: 1547 ttgtgtctatgttgggaacaagaggaactcccgggtacattgcaccagaagtatttagtc 1606

                                                                        
Query: 780  aaggaattttggtgtggtgtctcacaagtccgatgtttatagttttggaatgatggttct 839
             || |  |||||||  || |||||||| || ||||| ||||| ||||| ||| || ||||
Sbjct: 1607 gagca--tttggtggtgtttctcacaaatctgatgtgtatagctttggcatgttgattct 1664

                              
Query: 840  agaaatggttggaggaag 857
             |||||||||||||||||
Sbjct: 1665 tgaaatggttggaggaag 1682