Miyakogusa Predicted Gene

Lj2g3v1068840.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1068840.1 tr|G7KLC0|G7KLC0_MEDTR Purple acid phosphatase
OS=Medicago truncatula GN=MTR_6g013050 PE=4
SV=1,80.95,0,Metallophos,Metallophosphoesterase domain;
Metallophos_C,Iron/zinc purple acid phosphatase-like C-te,CUFF.36145.1
         (1764 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63560 homologue to UniRef100_Q3ZFI1 Cluster: Phytase;...    54   3e-06

>gnl|LJGI|TC63560 homologue to UniRef100_Q3ZFI1 Cluster: Phytase; n=1; Medicago
            truncatula|Rep: Phytase - Medicago truncatula (Barrel
            medic), partial (34%)
          Length = 1044

 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1186 gttgacattgttttcaatggtcatgttcatgcttatgagcgaatgaatagagtttataat 1245
            ||||||||||| |||||||| ||||||||||| || ||| ||   ||  |||| ||||| 
Sbjct: 145  gttgacattgtcttcaatggacatgttcatgcctacgagagatcaaaccgagtctataac 204

                                                           
Query: 1246 tacaccttggacccttgtggacctatttacattactgttggagatgg 1292
            ||||| ||||| |||||||| ||| |||| || || ||||| |||||
Sbjct: 205  tacacattggatccttgtggccctgtttatatcacggttggtgatgg 251