Miyakogusa Predicted Gene

Lj2g3v1034600.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1034600.1 Non Chatacterized Hit- tr|I1K2H7|I1K2H7_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,84.66,0,seg,NULL;
Mem_trans,Auxin efflux carrier; SUBFAMILY NOT NAMED,NULL; FAMILY NOT
NAMED,NULL; 2a69: aux,CUFF.36054.1
         (1080 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS353913 homologue to UniRef100_Q84YG8 Cluster: Auxin e...    68   1e-10
gnl|LJGI|GO027806 homologue to UniRef100_Q8H0E0 Cluster: PIN1-li...    56   5e-07

>gnl|LJGI|FS353913 homologue to UniRef100_Q84YG8 Cluster: Auxin efflux carrier
           protein; n=1; Medicago truncatula|Rep: Auxin efflux
           carrier protein - Medicago truncatula (Barrel medic),
           partial (11%)
          Length = 477

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                       
Query: 928 attgttcaggcagctctaccccaaggaatagttccttttgtttttgccagagagtacaat 987
           ||||||||||| ||||| ||||| || || ||||| ||||||||||||| ||| ||||||
Sbjct: 423 attgttcaggctgctcttccccagggtatcgttccctttgtttttgccaaagaatacaat 364

                     
Query: 988 gtccatccag 997
            |||||||||
Sbjct: 363 ctccatccag 354


>gnl|LJGI|GO027806 homologue to UniRef100_Q8H0E0 Cluster: PIN1-like auxin transport
           protein; n=1; Cucumis sativus|Rep: PIN1-like auxin
           transport protein - Cucumis sativus (Cucumber), partial
           (27%)
          Length = 766

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 928 attgttcaggcagctctaccccaaggaatagttccttttgtttttgccagagagtacaat 987
           ||||||||||||||||| || |||||||| || || ||||| |||||||  || ||||||
Sbjct: 322 attgttcaggcagctcttccacaaggaattgtcccatttgtgtttgccaaggaatacaat 263

                   
Query: 988 gtccatcc 995
           || |||||
Sbjct: 262 gtacatcc 255