Miyakogusa Predicted Gene

Lj2g3v0855230.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0855230.1 Non Chatacterized Hit- tr|I1J4J3|I1J4J3_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,89.31,0,ABC_membrane,ABC transporter, transmembrane domain;
ABC_tran,ABC transporter-like; ABC_TRANSPORTER_1,CUFF.35575.1
         (3336 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO036110 similar to UniRef100_A7Q0Z8 Cluster: Chromosom...    56   1e-06

>gnl|LJGI|GO036110 similar to UniRef100_A7Q0Z8 Cluster: Chromosome chr7 scaffold_42,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr7 scaffold_42, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (17%)
          Length = 759

 Score = 56.0 bits (28), Expect = 1e-06
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                
Query: 3074 aaagtggatgtgggaaatcaacagtgattgccttgattcagagattctatga 3125
            |||||||| |||||||||| ||||||||||||||| | || ||||| |||||
Sbjct: 69   aaagtggaagtgggaaatccacagtgattgccttgttgcaaagattttatga 120