Miyakogusa Predicted Gene

Lj2g3v0836940.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0836940.1 Non Chatacterized Hit- tr|F6HT83|F6HT83_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,70.97,0.0001,PROKAR_LIPOPROTEIN,NULL,CUFF.35539.1
         (162 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67929 similar to UniRef100_Q9SRQ8 Cluster: RING-H2 fi...    52   1e-06

>gnl|LJGI|TC67929 similar to UniRef100_Q9SRQ8 Cluster: RING-H2 finger protein ATL3A;
           n=2; Arabidopsis thaliana|Rep: RING-H2 finger protein
           ATL3A - Arabidopsis thaliana (Mouse-ear cress), partial
           (37%)
          Length = 668

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 66  tgggttagatgagactctcatcaaatccatcaccatttgcaagtac 111
           ||||||||||||  |||||||||||||||||||  ||| |||||||
Sbjct: 474 tgggttagatgaatctctcatcaaatccatcactgttttcaagtac 519