Miyakogusa Predicted Gene

Lj2g3v0777320.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0777320.1 Non Chatacterized Hit- tr|I1KIR7|I1KIR7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.7482 PE=,68.75,1e-17,
,CUFF.35420.1
         (240 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81088 similar to UniRef100_Q9ZTM9 Cluster: PGPS/D10; ...    54   4e-07
gnl|LJGI|TC73975 similar to UniRef100_Q9ZTM9 Cluster: PGPS/D10; ...    54   4e-07

>gnl|LJGI|TC81088 similar to UniRef100_Q9ZTM9 Cluster: PGPS/D10; n=1; Petunia x
           hybrida|Rep: PGPS/D10 - Petunia hybrida (Petunia),
           partial (21%)
          Length = 674

 Score = 54.0 bits (27), Expect = 4e-07
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 94  tgttctccaacgacacatgaaggttccttccggtgtcgtttgcatcg 140
           ||||||||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 197 tgttctccaaccacacatgaaggctctttccggtgccgttttcatcg 243



 Score = 50.1 bits (25), Expect = 6e-06
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 162 ttggatgaaacactccaattccatgcctgctaa 194
           ||||||||||| |||||| ||||||||||||||
Sbjct: 280 ttggatgaaacgctccaaatccatgcctgctaa 312


>gnl|LJGI|TC73975 similar to UniRef100_Q9ZTM9 Cluster: PGPS/D10; n=1; Petunia x
           hybrida|Rep: PGPS/D10 - Petunia hybrida (Petunia),
           partial (21%)
          Length = 528

 Score = 54.0 bits (27), Expect = 4e-07
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 94  tgttctccaacgacacatgaaggttccttccggtgtcgtttgcatcg 140
           ||||||||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 157 tgttctccaaccacacatgaaggctctttccggtgccgttttcatcg 203



 Score = 50.1 bits (25), Expect = 6e-06
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 162 ttggatgaaacactccaattccatgcctgctaa 194
           ||||||||||| |||||| ||||||||||||||
Sbjct: 240 ttggatgaaacgctccaaatccatgcctgctaa 272