Miyakogusa Predicted Gene
- Lj2g3v0777320.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v0777320.1 Non Chatacterized Hit- tr|I1KIR7|I1KIR7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.7482 PE=,68.75,1e-17,
,CUFF.35420.1
(240 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC81088 similar to UniRef100_Q9ZTM9 Cluster: PGPS/D10; ... 54 4e-07
gnl|LJGI|TC73975 similar to UniRef100_Q9ZTM9 Cluster: PGPS/D10; ... 54 4e-07
>gnl|LJGI|TC81088 similar to UniRef100_Q9ZTM9 Cluster: PGPS/D10; n=1; Petunia x
hybrida|Rep: PGPS/D10 - Petunia hybrida (Petunia),
partial (21%)
Length = 674
Score = 54.0 bits (27), Expect = 4e-07
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 94 tgttctccaacgacacatgaaggttccttccggtgtcgtttgcatcg 140
||||||||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 197 tgttctccaaccacacatgaaggctctttccggtgccgttttcatcg 243
Score = 50.1 bits (25), Expect = 6e-06
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 162 ttggatgaaacactccaattccatgcctgctaa 194
||||||||||| |||||| ||||||||||||||
Sbjct: 280 ttggatgaaacgctccaaatccatgcctgctaa 312
>gnl|LJGI|TC73975 similar to UniRef100_Q9ZTM9 Cluster: PGPS/D10; n=1; Petunia x
hybrida|Rep: PGPS/D10 - Petunia hybrida (Petunia),
partial (21%)
Length = 528
Score = 54.0 bits (27), Expect = 4e-07
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 94 tgttctccaacgacacatgaaggttccttccggtgtcgtttgcatcg 140
||||||||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 157 tgttctccaaccacacatgaaggctctttccggtgccgttttcatcg 203
Score = 50.1 bits (25), Expect = 6e-06
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 162 ttggatgaaacactccaattccatgcctgctaa 194
||||||||||| |||||| ||||||||||||||
Sbjct: 240 ttggatgaaacgctccaaatccatgcctgctaa 272