Miyakogusa Predicted Gene
- Lj2g3v0690100.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v0690100.1 Non Chatacterized Hit- tr|F6HKL7|F6HKL7_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,47.93,2e-19,seg,NULL; GLUTAREDOXIN_2,Glutaredoxin; no
description,Thioredoxin-like fold; GLUTAREDOXIN
DOMAIN-CON,NODE_77829_length_676_cov_9.853550.path1.1
(370 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC63307 similar to UniRef100_Q1SN07 Cluster: Thioredoxi... 718 0.0
gnl|LJGI|BP028689 similar to UniRef100_Q1SN07 Cluster: Thioredox... 240 5e-63
>gnl|LJGI|TC63307 similar to UniRef100_Q1SN07 Cluster: Thioredoxin fold; n=1;
Medicago truncatula|Rep: Thioredoxin fold - Medicago
truncatula (Barrel medic), partial (47%)
Length = 698
Score = 718 bits (362), Expect = 0.0
Identities = 368/370 (99%)
Strand = Plus / Plus
Query: 1 atggatagcggattcaaggaggagctcagaatgctcttcaaggggaaggggaaggatgct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 218 atggatagcggattcaaggaggagctcagaatgctcttcaaggggaaggggaaggatgct 277
Query: 61 tcaatgacaatggtggttccgcccaaggtgttcgtgaagggattctacatcggcggcgct 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 278 tcaatgacaatggtggttccgcccaaggtgttcgtgaagggattctacatcggcggcgct 337
Query: 121 gaggagatgttgaaagtggcagaggaaggtctattaggggaactgcttcagggattgccc 180
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 338 gaggagatgttgaaagtggcagaggagggtctattaggggaactgcttcagggattgccc 397
Query: 181 agaaaaccagttgttggggctgtttgtgagggttgtggggatctgagattcttgccctgc 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 agaaaaccagttgttggggctgtttgtgagggttgtggggatctgagattcttgccctgc 457
Query: 241 tttagttgcaatggcagctgcaaaatcgtgaaagctcacaaagagaaagaggggagtact 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 458 tttagttgcaatggcagctgcaaaatcgtgaaagctcacaaagagaaagaggggagtact 517
Query: 301 aggaacattgttgtgaagtgcaatgattgtaatgagaatgggttagtgctatgccctgtt 360
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 518 aggaacattgttgtgaagcgcaatgattgtaatgagaatgggttagtgctatgccctgtt 577
Query: 361 tgtagctgat 370
||||||||||
Sbjct: 578 tgtagctgat 587
>gnl|LJGI|BP028689 similar to UniRef100_Q1SN07 Cluster: Thioredoxin fold; n=1;
Medicago truncatula|Rep: Thioredoxin fold - Medicago
truncatula (Barrel medic), partial (43%)
Length = 563
Score = 240 bits (121), Expect = 5e-63
Identities = 121/121 (100%)
Strand = Plus / Plus
Query: 1 atggatagcggattcaaggaggagctcagaatgctcttcaaggggaaggggaaggatgct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 443 atggatagcggattcaaggaggagctcagaatgctcttcaaggggaaggggaaggatgct 502
Query: 61 tcaatgacaatggtggttccgcccaaggtgttcgtgaagggattctacatcggcggcgct 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 503 tcaatgacaatggtggttccgcccaaggtgttcgtgaagggattctacatcggcggcgct 562
Query: 121 g 121
|
Sbjct: 563 g 563