Miyakogusa Predicted Gene

Lj2g3v0690100.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0690100.1 Non Chatacterized Hit- tr|F6HKL7|F6HKL7_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,47.93,2e-19,seg,NULL; GLUTAREDOXIN_2,Glutaredoxin; no
description,Thioredoxin-like fold; GLUTAREDOXIN
DOMAIN-CON,NODE_77829_length_676_cov_9.853550.path1.1
         (370 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63307 similar to UniRef100_Q1SN07 Cluster: Thioredoxi...   718   0.0  
gnl|LJGI|BP028689 similar to UniRef100_Q1SN07 Cluster: Thioredox...   240   5e-63

>gnl|LJGI|TC63307 similar to UniRef100_Q1SN07 Cluster: Thioredoxin fold; n=1;
           Medicago truncatula|Rep: Thioredoxin fold - Medicago
           truncatula (Barrel medic), partial (47%)
          Length = 698

 Score =  718 bits (362), Expect = 0.0
 Identities = 368/370 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggatagcggattcaaggaggagctcagaatgctcttcaaggggaaggggaaggatgct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 218 atggatagcggattcaaggaggagctcagaatgctcttcaaggggaaggggaaggatgct 277

                                                                       
Query: 61  tcaatgacaatggtggttccgcccaaggtgttcgtgaagggattctacatcggcggcgct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 278 tcaatgacaatggtggttccgcccaaggtgttcgtgaagggattctacatcggcggcgct 337

                                                                       
Query: 121 gaggagatgttgaaagtggcagaggaaggtctattaggggaactgcttcagggattgccc 180
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 338 gaggagatgttgaaagtggcagaggagggtctattaggggaactgcttcagggattgccc 397

                                                                       
Query: 181 agaaaaccagttgttggggctgtttgtgagggttgtggggatctgagattcttgccctgc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 agaaaaccagttgttggggctgtttgtgagggttgtggggatctgagattcttgccctgc 457

                                                                       
Query: 241 tttagttgcaatggcagctgcaaaatcgtgaaagctcacaaagagaaagaggggagtact 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 458 tttagttgcaatggcagctgcaaaatcgtgaaagctcacaaagagaaagaggggagtact 517

                                                                       
Query: 301 aggaacattgttgtgaagtgcaatgattgtaatgagaatgggttagtgctatgccctgtt 360
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 518 aggaacattgttgtgaagcgcaatgattgtaatgagaatgggttagtgctatgccctgtt 577

                     
Query: 361 tgtagctgat 370
           ||||||||||
Sbjct: 578 tgtagctgat 587


>gnl|LJGI|BP028689 similar to UniRef100_Q1SN07 Cluster: Thioredoxin fold; n=1;
           Medicago truncatula|Rep: Thioredoxin fold - Medicago
           truncatula (Barrel medic), partial (43%)
          Length = 563

 Score =  240 bits (121), Expect = 5e-63
 Identities = 121/121 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggatagcggattcaaggaggagctcagaatgctcttcaaggggaaggggaaggatgct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 443 atggatagcggattcaaggaggagctcagaatgctcttcaaggggaaggggaaggatgct 502

                                                                       
Query: 61  tcaatgacaatggtggttccgcccaaggtgttcgtgaagggattctacatcggcggcgct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 503 tcaatgacaatggtggttccgcccaaggtgttcgtgaagggattctacatcggcggcgct 562

            
Query: 121 g 121
           |
Sbjct: 563 g 563