Miyakogusa Predicted Gene

Lj2g3v0659280.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0659280.1 Non Chatacterized Hit- tr|G7KQA5|G7KQA5_MEDTR
Putative uncharacterized protein OS=Medicago truncatul,72.06,4e-18,
,CUFF.35169.1
         (217 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO032242                                                     430   e-120
gnl|LJGI|TC70838 similar to UniRef100_Q6JH57 Cluster: Olfactory ...   430   e-120

>gnl|LJGI|GO032242 
          Length = 553

 Score =  430 bits (217), Expect = e-120
 Identities = 217/217 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   atggagaacatgaagatcaacgaagatggaagcttctcgcaaaagggtgtcccgattcat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 325 atggagaacatgaagatcaacgaagatggaagcttctcgcaaaagggtgtcccgattcat 266

                                                                       
Query: 61  agccaggttaggaagatcaagcaagaatcagagaaagttgttgactggtctcctggtcag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 265 agccaggttaggaagatcaagcaagaatcagagaaagttgttgactggtctcctggtcag 206

                                                                       
Query: 121 cctgagatgaggccagttctccgggatatttcccggcagatttcccggtcgccgttgggg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 205 cctgagatgaggccagttctccgggatatttcccggcagatttcccggtcgccgttgggg 146

                                                
Query: 181 atctccggcagaccaatttcagttggtgattcatagg 217
           |||||||||||||||||||||||||||||||||||||
Sbjct: 145 atctccggcagaccaatttcagttggtgattcatagg 109


>gnl|LJGI|TC70838 similar to UniRef100_Q6JH57 Cluster: Olfactory receptor; n=1;
           Ambystoma tigrinum|Rep: Olfactory receptor - Ambystoma
           tigrinum (Tiger salamander), partial (9%)
          Length = 543

 Score =  430 bits (217), Expect = e-120
 Identities = 217/217 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggagaacatgaagatcaacgaagatggaagcttctcgcaaaagggtgtcccgattcat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 117 atggagaacatgaagatcaacgaagatggaagcttctcgcaaaagggtgtcccgattcat 176

                                                                       
Query: 61  agccaggttaggaagatcaagcaagaatcagagaaagttgttgactggtctcctggtcag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 177 agccaggttaggaagatcaagcaagaatcagagaaagttgttgactggtctcctggtcag 236

                                                                       
Query: 121 cctgagatgaggccagttctccgggatatttcccggcagatttcccggtcgccgttgggg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 237 cctgagatgaggccagttctccgggatatttcccggcagatttcccggtcgccgttgggg 296

                                                
Query: 181 atctccggcagaccaatttcagttggtgattcatagg 217
           |||||||||||||||||||||||||||||||||||||
Sbjct: 297 atctccggcagaccaatttcagttggtgattcatagg 333