Miyakogusa Predicted Gene

Lj2g3v0636810.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0636810.1 Non Chatacterized Hit- tr|I1MQN3|I1MQN3_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max PE=4,79.5,0,PROTEIN
KINASE-RELATED,NULL; UNCHARACTERIZED,NULL; no description,NULL;
Malectin_like,Malectin-like ,CUFF.35120.1
         (1641 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77313 similar to UniRef100_Q4K679 Cluster: Probable p...   323   2e-87

>gnl|LJGI|TC77313 similar to UniRef100_Q4K679 Cluster: Probable permease of ABC
            transporter PA0204; n=1; Pseudomonas fluorescens
            Pf-5|Rep: Probable permease of ABC transporter PA0204 -
            Pseudomonas fluorescens (strain Pf-5 / ATCC BAA-477),
            partial (6%)
          Length = 419

 Score =  323 bits (163), Expect = 2e-87
 Identities = 163/163 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1479 cttttcaggcgatgaaccgaataatccaccgcctccgccgttgaatctttttgctgggga 1538
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    cttttcaggcgatgaaccgaataatccaccgcctccgccgttgaatctttttgctgggga 60

                                                                        
Query: 1539 tgattcagtaggagtgggaagtggaagcgtgaagaataacaagctgaacatattattcat 1598
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61   tgattcagtaggagtgggaagtggaagcgtgaagaataacaagctgaacatattattcat 120

                                                       
Query: 1599 agtagctactttgctaccactgcttttcgtgaaatttatatga 1641
            |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121  agtagctactttgctaccactgcttttcgtgaaatttatatga 163