Miyakogusa Predicted Gene

Lj2g3v0636560.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0636560.1 Non Chatacterized Hit- tr|I1KKH6|I1KKH6_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,72.92,0.000000009,
,NODE_107774_length_725_cov_7.645517.path1.1
         (303 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO037446 similar to UniRef100_Q6GYB5 Cluster: Verticill...    66   1e-10

>gnl|LJGI|GO037446 similar to UniRef100_Q6GYB5 Cluster: Verticillium wilt disease
           resistance protein; n=2; Solanum aethiopicum|Rep:
           Verticillium, partial (1%)
          Length = 281

 Score = 65.9 bits (33), Expect = 1e-10
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 1   atgggagtaacatgtgacaagaagggacatgtttctggtcttgat 45
           ||||| ||||||||||||||| ||||||||||| |||||||||||
Sbjct: 237 atgggggtaacatgtgacaaggagggacatgttactggtcttgat 281