Miyakogusa Predicted Gene

Lj2g3v0635150.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0635150.1 tr|G7KJR2|G7KJR2_MEDTR Resistance protein
OS=Medicago truncatula GN=MTR_6g075870 PE=4 SV=1,28.03,0.042,no
description,NULL; Toll,Toll/interleukin-1 receptor homology (TIR)
domain; Toll/Interleukin recept,FS318368.path2.1
         (534 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS318368 similar to UniRef100_Q84ZV8 Cluster: R 3 prote...  1059   0.0  
gnl|LJGI|TC67921 weakly similar to UniRef100_Q8W2C0 Cluster: Fun...   137   8e-32
gnl|LJGI|TC60890 weakly similar to UniRef100_Q8W2C0 Cluster: Fun...   133   1e-30
gnl|LJGI|DC599941 weakly similar to UniRef100_A7QH65 Cluster: Ch...    90   2e-17
gnl|LJGI|TC59247 weakly similar to UniRef100_Q9FVK2 Cluster: Res...    84   1e-15
gnl|LJGI|DC600032 similar to UniRef100_Q84ZV8 Cluster: R 3 prote...    62   4e-09
gnl|LJGI|TC60415 weakly similar to UniRef100_Q84ZV0 Cluster: R 1...    62   4e-09

>gnl|LJGI|FS318368 similar to UniRef100_Q84ZV8 Cluster: R 3 protein; n=2; Glycine
           max|Rep: R 3 protein - Glycine max (Soybean), partial
           (15%)
          Length = 788

 Score = 1059 bits (534), Expect = 0.0
 Identities = 534/534 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctctgccacaatcccccttttcctccttcactaatgaatttacctatgatgtgttc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 255 atggctctgccacaatcccccttttcctccttcactaatgaatttacctatgatgtgttc 314

                                                                       
Query: 61  cttagcttcaggggtcccgacactcgtcactgttttactggcaatctttggaaaggtctt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 315 cttagcttcaggggtcccgacactcgtcactgttttactggcaatctttggaaaggtctt 374

                                                                       
Query: 121 tctgacagcggaatcaacaccttcattgatgacaaggagcttgagagaggggatgaaatc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 375 tctgacagcggaatcaacaccttcattgatgacaaggagcttgagagaggggatgaaatc 434

                                                                       
Query: 181 acaccggcacttgttaaggccattcaagagtcaaggattgccatccccgtgctctctacc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 435 acaccggcacttgttaaggccattcaagagtcaaggattgccatccccgtgctctctacc 494

                                                                       
Query: 241 aactatgcctcttcttccttttgcctagatgagcttgtaaacatccttgaccggcggctc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 495 aactatgcctcttcttccttttgcctagatgagcttgtaaacatccttgaccggcggctc 554

                                                                       
Query: 301 gaagcaaaaggtcggttggttttgccggttttctataacgtggatccttctcatgtgcgg 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 555 gaagcaaaaggtcggttggttttgccggttttctataacgtggatccttctcatgtgcgg 614

                                                                       
Query: 361 catcagactgggagttatggagaagcacttgctaagcatgaagagaggtttacaaataac 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 615 catcagactgggagttatggagaagcacttgctaagcatgaagagaggtttacaaataac 674

                                                                       
Query: 421 atggaaaatttcacaggtaacatggagaggttgcagaaatggaaggtggctctgcaccaa 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 675 atggaaaatttcacaggtaacatggagaggttgcagaaatggaaggtggctctgcaccaa 734

                                                                 
Query: 481 gtagctagcttgtctggtcaccatttcaaacctagatatgatacatttagtatg 534
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 735 gtagctagcttgtctggtcaccatttcaaacctagatatgatacatttagtatg 788


>gnl|LJGI|TC67921 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
           resistance protein KR1; n=1; Glycine max|Rep: Functional
           candidate resistance protein KR1 - Glycine max
           (Soybean), partial (17%)
          Length = 832

 Score =  137 bits (69), Expect = 8e-32
 Identities = 188/227 (82%), Gaps = 3/227 (1%)
 Strand = Plus / Plus

                                                                       
Query: 130 ggaatcaacaccttcattgatgacaaggagcttgagagaggggatgaaatcacaccggca 189
           |||||| |||||||||||||||| ||||| ||| ||||||| |||||||||||||| |||
Sbjct: 270 ggaatccacaccttcattgatgataaggaccttaagagaggagatgaaatcacacccgca 329

                                                                       
Query: 190 cttgttaaggccattcaagagtcaaggattgccatccccgtgctctctaccaactatgcc 249
           ||| | ||||||||||||||||| ||||| ||||||||  |  |||||   |||||||| 
Sbjct: 330 cttatcaaggccattcaagagtcgaggatcgccatccctatcttctctgtgaactatgct 389

                                                                       
Query: 250 tcttcttccttttgcctagatgagcttgtaaacatccttgaccggcggctcgaagcaaaa 309
           |||||||| |||||||| ||||| ||||| |  ||| | ||   | |  || | ||||||
Sbjct: 390 tcttcttcattttgcctggatgaacttgtcacaatcataga---gtgtgtcaaggcaaaa 446

                                                          
Query: 310 ggtcggttggttttgccggttttctataacgtggatccttctcatgt 356
           || ||||||||| | |||||||||||| | |||||||||||||||||
Sbjct: 447 gggcggttggttcttccggttttctatgatgtggatccttctcatgt 493


>gnl|LJGI|TC60890 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
           resistance protein KR1; n=1; Glycine max|Rep: Functional
           candidate resistance protein KR1 - Glycine max
           (Soybean), partial (20%)
          Length = 810

 Score =  133 bits (67), Expect = 1e-30
 Identities = 284/354 (80%), Gaps = 3/354 (0%)
 Strand = Plus / Plus

                                                                       
Query: 112 aaaggtctttctgacagcggaatcaacaccttcattgatgacaaggagcttgagagaggg 171
           |||| ||||| |||||  ||||||  ||||||| ||||||| |||||||| |||||||||
Sbjct: 183 aaagctctttgtgacaagggaatccgcaccttctttgatgataaggagctggagagaggg 242

                                                                       
Query: 172 gatgaaatcacaccggcacttgttaaggccattcaagagtcaaggattgccatccccgtg 231
           || ||||||||||| |||||||| || |||||||||||||| |||||||| ||||| || 
Sbjct: 243 gaagaaatcacacctgcacttgtcaaagccattcaagagtccaggattgctatccctgta 302

                                                                       
Query: 232 ctctctaccaactatgcctcttcttccttttgcctagatgagcttgtaaacatccttgac 291
            ||||  | | |||||| ||||||||||||||| | ||||| ||||| | |||| |||||
Sbjct: 303 ttctcagcaagctatgcttcttcttccttttgcttggatgaacttgtcaccatcattgac 362

                                                                       
Query: 292 cggcggctcgaagcaaaaggtcggttggttttgccggttttctataacgtggatccttct 351
           | ||     ||| |  ||||||||||||| ||||| || || ||| | || |||||||||
Sbjct: 363 c-gcattaagaacc--aaggtcggttggtcttgcctgtcttttatgatgttgatccttct 419

                                                                       
Query: 352 catgtgcggcatcagactgggagttatggagaagcacttgctaagcatgaagagaggttt 411
            | ||| | ||||| |||||||||||   |||||  || | ||||||| | | || ||||
Sbjct: 420 aaggtgagacatcaaactgggagttacaaagaagatctggataagcatcaggtgaagttt 479

                                                                 
Query: 412 acaaataacatggaaaatttcacaggtaacatggagaggttgcagaaatggaag 465
             | | || |||||||| ||||| | |||||||||||||||| |||||||||||
Sbjct: 480 gaacagaatatggaaaagttcacggataacatggagaggttgaagaaatggaag 533


>gnl|LJGI|DC599941 weakly similar to UniRef100_A7QH65 Cluster: Chromosome chr18
           scaffold_96, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr18 scaffold_96, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (11%)
          Length = 546

 Score = 89.7 bits (45), Expect = 2e-17
 Identities = 288/365 (78%), Gaps = 8/365 (2%)
 Strand = Plus / Plus

                                                                       
Query: 138 caccttcattgatgacaaggagcttgagagaggggatgaaatcacaccggcacttgttaa 197
           ||||||||| || ||| |||||||| ||||||| ||||||||||||||| |||| || ||
Sbjct: 109 caccttcatcgacgacgaggagcttcagagaggagatgaaatcacaccgtcactcgtcaa 168

                                                                       
Query: 198 ggccattcaagagtcaaggattgccatccccgtgctctctaccaactatgcctcttcttc 257
            |||||| ||  ||| || || ||||| || ||| |||||| || |||||| ||||||||
Sbjct: 169 agccattgaacggtccagaatcgccattccagtgttctctaacagctatgcttcttcttc 228

                                                                       
Query: 258 cttttgcctagatgagcttgtaaacatccttgaccggcggctcgaagcaaaaggtc-ggt 316
            |||||| ||||||| ||||  || ||  ||||      | |  ||| | |||| | |||
Sbjct: 229 gttttgcttagatgaacttgccaagatttttga----gtgttttaagaagaagggcaggt 284

                                                                       
Query: 317 tggttttgccggttttctataacgtggatccttctcatgtgcg--gcatc-agactggga 373
           |||||||||| ||||| ||| | ||| |||||||| |||||||  ||  | |||| ||||
Sbjct: 285 tggttttgcctgttttttatgatgtgaatccttctgatgtgcggtgcggcgagaccggga 344

                                                                       
Query: 374 gttatggagaagcacttgctaagcatgaagagaggtttacaaataacatggaaaatttca 433
           ||||||||| ||| || |||| ||||||||||||||||| |||||  | ||| | |||  
Sbjct: 345 gttatggagtagctctggctatgcatgaagagaggtttagaaatatgaaggagagttttg 404

                                                                       
Query: 434 caggtaacatggagaggttgcagaaatggaaggtggctctgcaccaagtagctagcttgt 493
             | |||||||||||||||| ||||||||||||| |||||  | ||||  |||| |||||
Sbjct: 405 aggataacatggagaggttgaagaaatggaaggttgctcttaagcaagctgctaacttgt 464

                
Query: 494 ctggt 498
           |||||
Sbjct: 465 ctggt 469


>gnl|LJGI|TC59247 weakly similar to UniRef100_Q9FVK2 Cluster: Resistance protein
           MG13; n=1; Glycine max|Rep: Resistance protein MG13 -
           Glycine max (Soybean), partial (49%)
          Length = 764

 Score = 83.8 bits (42), Expect = 1e-15
 Identities = 147/182 (80%)
 Strand = Plus / Plus

                                                                       
Query: 46  acctatgatgtgttccttagcttcaggggtcccgacactcgtcactgttttactggcaat 105
           ||||||||||||||| | |||||||| ||    || ||||||||  |||| ||||| |||
Sbjct: 114 acctatgatgtgttcataagcttcagaggctatgatactcgtcatggtttcactggtaat 173

                                                                       
Query: 106 ctttggaaaggtctttctgacagcggaatcaacaccttcattgatgacaaggagcttgag 165
           || |  |||| ||||| |||||  ||||||  ||||||| ||||||| || ||||| |||
Sbjct: 174 ctctacaaagctctttgtgacaagggaatccgcaccttctttgatgataaagagctggag 233

                                                                       
Query: 166 agaggggatgaaatcacaccggcacttgttaaggccattcaagagtcaaggattgccatc 225
           |||||||| ||||||||||| | |||||| || ||||||   ||||| |||||||| |||
Sbjct: 234 agaggggaagaaatcacaccagtacttgtcaaagccattgctgagtccaggattgctatc 293

             
Query: 226 cc 227
           ||
Sbjct: 294 cc 295


>gnl|LJGI|DC600032 similar to UniRef100_Q84ZV8 Cluster: R 3 protein; n=2; Glycine
           max|Rep: R 3 protein - Glycine max (Soybean), partial
           (13%)
          Length = 593

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 130 ggaatcaacaccttcattgatgacaaggagcttgagagaggggatgaaatcacaccggca 189
           |||||| |||| || |||||||||||||||||| | | |||||| |||||||| || |||
Sbjct: 291 ggaatccacacatttattgatgacaaggagcttcacaaaggggacgaaatcaccccagca 350

                                              
Query: 190 cttgttaaggccattcaagagtcaaggattgccat 224
           ||||   |||||||| || | || |||||||||||
Sbjct: 351 cttgaggaggccattgaaaaatctaggattgccat 385


>gnl|LJGI|TC60415 weakly similar to UniRef100_Q84ZV0 Cluster: R 14 protein; n=1;
           Glycine max|Rep: R 14 protein - Glycine max (Soybean),
           partial (31%)
          Length = 836

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 145 attgatgacaaggagcttgagagaggggatgaaatcacaccggcacttgttaaggccatt 204
           |||||||||||||||||| | | |||||| |||||||||||  ||||||  |||||||||
Sbjct: 321 attgatgacaaggagcttcacaaaggggacgaaatcacaccatcacttgagaaggccatt 380

              
Query: 205 caa 207
           |||
Sbjct: 381 caa 383