Miyakogusa Predicted Gene
- Lj2g3v0635150.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v0635150.1 tr|G7KJR2|G7KJR2_MEDTR Resistance protein
OS=Medicago truncatula GN=MTR_6g075870 PE=4 SV=1,28.03,0.042,no
description,NULL; Toll,Toll/interleukin-1 receptor homology (TIR)
domain; Toll/Interleukin recept,FS318368.path2.1
(534 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS318368 similar to UniRef100_Q84ZV8 Cluster: R 3 prote... 1059 0.0
gnl|LJGI|TC67921 weakly similar to UniRef100_Q8W2C0 Cluster: Fun... 137 8e-32
gnl|LJGI|TC60890 weakly similar to UniRef100_Q8W2C0 Cluster: Fun... 133 1e-30
gnl|LJGI|DC599941 weakly similar to UniRef100_A7QH65 Cluster: Ch... 90 2e-17
gnl|LJGI|TC59247 weakly similar to UniRef100_Q9FVK2 Cluster: Res... 84 1e-15
gnl|LJGI|DC600032 similar to UniRef100_Q84ZV8 Cluster: R 3 prote... 62 4e-09
gnl|LJGI|TC60415 weakly similar to UniRef100_Q84ZV0 Cluster: R 1... 62 4e-09
>gnl|LJGI|FS318368 similar to UniRef100_Q84ZV8 Cluster: R 3 protein; n=2; Glycine
max|Rep: R 3 protein - Glycine max (Soybean), partial
(15%)
Length = 788
Score = 1059 bits (534), Expect = 0.0
Identities = 534/534 (100%)
Strand = Plus / Plus
Query: 1 atggctctgccacaatcccccttttcctccttcactaatgaatttacctatgatgtgttc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 255 atggctctgccacaatcccccttttcctccttcactaatgaatttacctatgatgtgttc 314
Query: 61 cttagcttcaggggtcccgacactcgtcactgttttactggcaatctttggaaaggtctt 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 315 cttagcttcaggggtcccgacactcgtcactgttttactggcaatctttggaaaggtctt 374
Query: 121 tctgacagcggaatcaacaccttcattgatgacaaggagcttgagagaggggatgaaatc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 375 tctgacagcggaatcaacaccttcattgatgacaaggagcttgagagaggggatgaaatc 434
Query: 181 acaccggcacttgttaaggccattcaagagtcaaggattgccatccccgtgctctctacc 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 435 acaccggcacttgttaaggccattcaagagtcaaggattgccatccccgtgctctctacc 494
Query: 241 aactatgcctcttcttccttttgcctagatgagcttgtaaacatccttgaccggcggctc 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 495 aactatgcctcttcttccttttgcctagatgagcttgtaaacatccttgaccggcggctc 554
Query: 301 gaagcaaaaggtcggttggttttgccggttttctataacgtggatccttctcatgtgcgg 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 555 gaagcaaaaggtcggttggttttgccggttttctataacgtggatccttctcatgtgcgg 614
Query: 361 catcagactgggagttatggagaagcacttgctaagcatgaagagaggtttacaaataac 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 615 catcagactgggagttatggagaagcacttgctaagcatgaagagaggtttacaaataac 674
Query: 421 atggaaaatttcacaggtaacatggagaggttgcagaaatggaaggtggctctgcaccaa 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 675 atggaaaatttcacaggtaacatggagaggttgcagaaatggaaggtggctctgcaccaa 734
Query: 481 gtagctagcttgtctggtcaccatttcaaacctagatatgatacatttagtatg 534
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 735 gtagctagcttgtctggtcaccatttcaaacctagatatgatacatttagtatg 788
>gnl|LJGI|TC67921 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
resistance protein KR1; n=1; Glycine max|Rep: Functional
candidate resistance protein KR1 - Glycine max
(Soybean), partial (17%)
Length = 832
Score = 137 bits (69), Expect = 8e-32
Identities = 188/227 (82%), Gaps = 3/227 (1%)
Strand = Plus / Plus
Query: 130 ggaatcaacaccttcattgatgacaaggagcttgagagaggggatgaaatcacaccggca 189
|||||| |||||||||||||||| ||||| ||| ||||||| |||||||||||||| |||
Sbjct: 270 ggaatccacaccttcattgatgataaggaccttaagagaggagatgaaatcacacccgca 329
Query: 190 cttgttaaggccattcaagagtcaaggattgccatccccgtgctctctaccaactatgcc 249
||| | ||||||||||||||||| ||||| |||||||| | ||||| ||||||||
Sbjct: 330 cttatcaaggccattcaagagtcgaggatcgccatccctatcttctctgtgaactatgct 389
Query: 250 tcttcttccttttgcctagatgagcttgtaaacatccttgaccggcggctcgaagcaaaa 309
|||||||| |||||||| ||||| ||||| | ||| | || | | || | ||||||
Sbjct: 390 tcttcttcattttgcctggatgaacttgtcacaatcataga---gtgtgtcaaggcaaaa 446
Query: 310 ggtcggttggttttgccggttttctataacgtggatccttctcatgt 356
|| ||||||||| | |||||||||||| | |||||||||||||||||
Sbjct: 447 gggcggttggttcttccggttttctatgatgtggatccttctcatgt 493
>gnl|LJGI|TC60890 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
resistance protein KR1; n=1; Glycine max|Rep: Functional
candidate resistance protein KR1 - Glycine max
(Soybean), partial (20%)
Length = 810
Score = 133 bits (67), Expect = 1e-30
Identities = 284/354 (80%), Gaps = 3/354 (0%)
Strand = Plus / Plus
Query: 112 aaaggtctttctgacagcggaatcaacaccttcattgatgacaaggagcttgagagaggg 171
|||| ||||| ||||| |||||| ||||||| ||||||| |||||||| |||||||||
Sbjct: 183 aaagctctttgtgacaagggaatccgcaccttctttgatgataaggagctggagagaggg 242
Query: 172 gatgaaatcacaccggcacttgttaaggccattcaagagtcaaggattgccatccccgtg 231
|| ||||||||||| |||||||| || |||||||||||||| |||||||| ||||| ||
Sbjct: 243 gaagaaatcacacctgcacttgtcaaagccattcaagagtccaggattgctatccctgta 302
Query: 232 ctctctaccaactatgcctcttcttccttttgcctagatgagcttgtaaacatccttgac 291
|||| | | |||||| ||||||||||||||| | ||||| ||||| | |||| |||||
Sbjct: 303 ttctcagcaagctatgcttcttcttccttttgcttggatgaacttgtcaccatcattgac 362
Query: 292 cggcggctcgaagcaaaaggtcggttggttttgccggttttctataacgtggatccttct 351
| || ||| | ||||||||||||| ||||| || || ||| | || |||||||||
Sbjct: 363 c-gcattaagaacc--aaggtcggttggtcttgcctgtcttttatgatgttgatccttct 419
Query: 352 catgtgcggcatcagactgggagttatggagaagcacttgctaagcatgaagagaggttt 411
| ||| | ||||| ||||||||||| ||||| || | ||||||| | | || ||||
Sbjct: 420 aaggtgagacatcaaactgggagttacaaagaagatctggataagcatcaggtgaagttt 479
Query: 412 acaaataacatggaaaatttcacaggtaacatggagaggttgcagaaatggaag 465
| | || |||||||| ||||| | |||||||||||||||| |||||||||||
Sbjct: 480 gaacagaatatggaaaagttcacggataacatggagaggttgaagaaatggaag 533
>gnl|LJGI|DC599941 weakly similar to UniRef100_A7QH65 Cluster: Chromosome chr18
scaffold_96, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr18 scaffold_96, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (11%)
Length = 546
Score = 89.7 bits (45), Expect = 2e-17
Identities = 288/365 (78%), Gaps = 8/365 (2%)
Strand = Plus / Plus
Query: 138 caccttcattgatgacaaggagcttgagagaggggatgaaatcacaccggcacttgttaa 197
||||||||| || ||| |||||||| ||||||| ||||||||||||||| |||| || ||
Sbjct: 109 caccttcatcgacgacgaggagcttcagagaggagatgaaatcacaccgtcactcgtcaa 168
Query: 198 ggccattcaagagtcaaggattgccatccccgtgctctctaccaactatgcctcttcttc 257
|||||| || ||| || || ||||| || ||| |||||| || |||||| ||||||||
Sbjct: 169 agccattgaacggtccagaatcgccattccagtgttctctaacagctatgcttcttcttc 228
Query: 258 cttttgcctagatgagcttgtaaacatccttgaccggcggctcgaagcaaaaggtc-ggt 316
|||||| ||||||| |||| || || |||| | | ||| | |||| | |||
Sbjct: 229 gttttgcttagatgaacttgccaagatttttga----gtgttttaagaagaagggcaggt 284
Query: 317 tggttttgccggttttctataacgtggatccttctcatgtgcg--gcatc-agactggga 373
|||||||||| ||||| ||| | ||| |||||||| ||||||| || | |||| ||||
Sbjct: 285 tggttttgcctgttttttatgatgtgaatccttctgatgtgcggtgcggcgagaccggga 344
Query: 374 gttatggagaagcacttgctaagcatgaagagaggtttacaaataacatggaaaatttca 433
||||||||| ||| || |||| ||||||||||||||||| ||||| | ||| | |||
Sbjct: 345 gttatggagtagctctggctatgcatgaagagaggtttagaaatatgaaggagagttttg 404
Query: 434 caggtaacatggagaggttgcagaaatggaaggtggctctgcaccaagtagctagcttgt 493
| |||||||||||||||| ||||||||||||| ||||| | |||| |||| |||||
Sbjct: 405 aggataacatggagaggttgaagaaatggaaggttgctcttaagcaagctgctaacttgt 464
Query: 494 ctggt 498
|||||
Sbjct: 465 ctggt 469
>gnl|LJGI|TC59247 weakly similar to UniRef100_Q9FVK2 Cluster: Resistance protein
MG13; n=1; Glycine max|Rep: Resistance protein MG13 -
Glycine max (Soybean), partial (49%)
Length = 764
Score = 83.8 bits (42), Expect = 1e-15
Identities = 147/182 (80%)
Strand = Plus / Plus
Query: 46 acctatgatgtgttccttagcttcaggggtcccgacactcgtcactgttttactggcaat 105
||||||||||||||| | |||||||| || || |||||||| |||| ||||| |||
Sbjct: 114 acctatgatgtgttcataagcttcagaggctatgatactcgtcatggtttcactggtaat 173
Query: 106 ctttggaaaggtctttctgacagcggaatcaacaccttcattgatgacaaggagcttgag 165
|| | |||| ||||| ||||| |||||| ||||||| ||||||| || ||||| |||
Sbjct: 174 ctctacaaagctctttgtgacaagggaatccgcaccttctttgatgataaagagctggag 233
Query: 166 agaggggatgaaatcacaccggcacttgttaaggccattcaagagtcaaggattgccatc 225
|||||||| ||||||||||| | |||||| || |||||| ||||| |||||||| |||
Sbjct: 234 agaggggaagaaatcacaccagtacttgtcaaagccattgctgagtccaggattgctatc 293
Query: 226 cc 227
||
Sbjct: 294 cc 295
>gnl|LJGI|DC600032 similar to UniRef100_Q84ZV8 Cluster: R 3 protein; n=2; Glycine
max|Rep: R 3 protein - Glycine max (Soybean), partial
(13%)
Length = 593
Score = 61.9 bits (31), Expect = 4e-09
Identities = 79/95 (83%)
Strand = Plus / Plus
Query: 130 ggaatcaacaccttcattgatgacaaggagcttgagagaggggatgaaatcacaccggca 189
|||||| |||| || |||||||||||||||||| | | |||||| |||||||| || |||
Sbjct: 291 ggaatccacacatttattgatgacaaggagcttcacaaaggggacgaaatcaccccagca 350
Query: 190 cttgttaaggccattcaagagtcaaggattgccat 224
|||| |||||||| || | || |||||||||||
Sbjct: 351 cttgaggaggccattgaaaaatctaggattgccat 385
>gnl|LJGI|TC60415 weakly similar to UniRef100_Q84ZV0 Cluster: R 14 protein; n=1;
Glycine max|Rep: R 14 protein - Glycine max (Soybean),
partial (31%)
Length = 836
Score = 61.9 bits (31), Expect = 4e-09
Identities = 55/63 (87%)
Strand = Plus / Plus
Query: 145 attgatgacaaggagcttgagagaggggatgaaatcacaccggcacttgttaaggccatt 204
|||||||||||||||||| | | |||||| ||||||||||| |||||| |||||||||
Sbjct: 321 attgatgacaaggagcttcacaaaggggacgaaatcacaccatcacttgagaaggccatt 380
Query: 205 caa 207
|||
Sbjct: 381 caa 383