Miyakogusa Predicted Gene

Lj2g3v0633850.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0633850.1 Non Chatacterized Hit- tr|I1L3Z8|I1L3Z8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.37595 PE,97.62,0,Protein
kinase-like (PK-like),Protein kinase-like domain; no description,NULL;
PROTEIN_KINASE_DOM,Pr,CUFF.35099.1
         (633 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO035882 similar to UniRef100_UPI000034F538 Cluster: pr...   391   e-108
gnl|LJGI|TC68417 homologue to UniRef100_A7P2Q9 Cluster: Chromoso...   145   4e-34

>gnl|LJGI|GO035882 similar to UniRef100_UPI000034F538 Cluster: protein kinase family
           protein; n=1; Arabidopsis thaliana|Rep: protein kinase
           family protein - Arabidopsis thaliana, partial (15%)
          Length = 755

 Score =  391 bits (197), Expect = e-108
 Identities = 197/197 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggatgtttgtgttaaaattataaagaacaacaaagacttcttcgaccaaagccttgat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 559 atggatgtttgtgttaaaattataaagaacaacaaagacttcttcgaccaaagccttgat 618

                                                                       
Query: 61  gagatcaagcttctcaagtatgtcaataagcatgaccctggagacaagtatcaccttctg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 619 gagatcaagcttctcaagtatgtcaataagcatgaccctggagacaagtatcaccttctg 678

                                                                       
Query: 121 cgattatatgactatttctattatagagaacatttgttaatagtatgtgaactacttaaa 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 679 cgattatatgactatttctattatagagaacatttgttaatagtatgtgaactacttaaa 738

                            
Query: 181 gccaacttatatgagtt 197
           |||||||||||||||||
Sbjct: 739 gccaacttatatgagtt 755


>gnl|LJGI|TC68417 homologue to UniRef100_A7P2Q9 Cluster: Chromosome chr1 scaffold_5,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr1 scaffold_5, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (35%)
          Length = 1033

 Score =  145 bits (73), Expect = 4e-34
 Identities = 73/73 (100%)
 Strand = Plus / Plus

                                                                       
Query: 561 cacattacttgctcgggtgattgggatcattggtccaattgatcaaagtttgcttgcaaa 620
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   cacattacttgctcgggtgattgggatcattggtccaattgatcaaagtttgcttgcaaa 60

                        
Query: 621 aggacgggataca 633
           |||||||||||||
Sbjct: 61  aggacgggataca 73