Miyakogusa Predicted Gene
- Lj2g3v0632410.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v0632410.1 tr|G7JX91|G7JX91_MEDTR F-box/kelch-repeat protein
OS=Medicago truncatula GN=MTR_5g057710 PE=4 SV=1,33.33,0.028,seg,NULL;
SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL; F-box,F-box domain,
cyclin-like; F_box_as,CUFF.34949.1
(1221 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS328144 similar to UniRef100_A7Q9Q9 Cluster: Chromosom... 922 0.0
gnl|LJGI|TC74128 similar to UniRef100_A7Q9Q9 Cluster: Chromosome... 172 3e-42
gnl|LJGI|TC75160 weakly similar to UniRef100_A7Q9Q9 Cluster: Chr... 113 3e-24
gnl|LJGI|AV423520 similar to UniRef100_Q2HWB4 Cluster: Cyclin-li... 80 4e-14
gnl|LJGI|BP079620 similar to UniRef100_A7Q9Q0 Cluster: Chromosom... 78 1e-13
gnl|LJGI|TC76533 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik... 70 4e-11
gnl|LJGI|DC593954 similar to UniRef100_Q2HWB4 Cluster: Cyclin-li... 66 6e-10
gnl|LJGI|FS318183 weakly similar to UniRef100_A7Q9Q9 Cluster: Ch... 64 2e-09
gnl|LJGI|TC65255 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik... 62 9e-09
gnl|LJGI|DC595381 weakly similar to UniRef100_Q2HS67 Cluster: Cy... 56 5e-07
gnl|LJGI|BP049904 54 2e-06
gnl|LJGI|TC77565 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik... 54 2e-06
gnl|LJGI|TC75940 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik... 54 2e-06
gnl|LJGI|TC82797 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik... 52 8e-06
gnl|LJGI|TC60928 52 8e-06
>gnl|LJGI|FS328144 similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5 scaffold_67,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr5 scaffold_67, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (9%)
Length = 760
Score = 922 bits (465), Expect = 0.0
Identities = 468/469 (99%)
Strand = Plus / Plus
Query: 1 atggcaccaggtggtgacacgaacgacggtgttttcccaactccatcacggaagactcag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 292 atggcaccaggtggtgacacgaacgacggtgttttcccaactccatcacggaagactcag 351
Query: 61 cggttcaccacctccaccggaaccctaacatcaccttcgctcccttcctcttccaactct 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 352 cggttcaccacctccaccggaaccctaacatcaccttcgctcccttcctcttccaactct 411
Query: 121 cccggcggtgaccttcgtccgccgctgacacttcccacacttccattcgagctcatggaa 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 412 cccggcggtgaccttcgtccgccgctgacacttcccacacttccattcgagctcatggaa 471
Query: 181 gttatcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcc 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 472 gttatcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcc 531
Query: 241 tggaatctcctgatttccgatcccaaattcgccagaaggcaccttcgcgagttcaaccgc 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 532 tggaatctcctgatttccgatcccaaattcgccagaaggcaccttcgcgagttcaaccgc 591
Query: 301 tacaatctcattgtaaaatccaggaaccatgtcaactcttattcacacagctccaccact 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 592 tacaatctcattgtaaaatccaggaaccatgtcaactcttattcacacagctccaccact 651
Query: 361 ttcaacaacacaatgattctcagctcgacgcggctagagtaccctctcaaccgcgatatc 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 652 ttcaacaacacaatgattctcagctcgacgcggctagagtaccctctcaaccgcgatatc 711
Query: 421 cgtaacgatcttgttggctcgtgcgatggtatgctctgtttctgcgccc 469
||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 712 cgtaacgatctcgttggctcgtgcgatggtatgctctgtttctgcgccc 760
>gnl|LJGI|TC74128 similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5 scaffold_67,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr5 scaffold_67, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (9%)
Length = 501
Score = 172 bits (87), Expect = 3e-42
Identities = 138/155 (89%)
Strand = Plus / Plus
Query: 151 cttcccacacttccattcgagctcatggaagttatcctctgcaggcttccggtgaagtct 210
||||| || ||| ||| ||||||| |||||| ||||| || ||| ||||||||||||||
Sbjct: 175 cttccaacccttgcatccgagctcgtggaagaaatcctatgtagggttccggtgaagtct 234
Query: 211 ctcttgcgattccggtgcgtctgcaagtcctggaatctcctgatttccgatcccaaattc 270
|| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||
Sbjct: 235 cttttgcgattccggtgcgtctgcaagtcctggaattccctgatttctgatcccaaattc 294
Query: 271 gccagaaggcaccttcgcgagttcaaccgctacaa 305
||||||| ||||| |||||||| ||||||||||||
Sbjct: 295 gccagaaagcaccgtcgcgagtacaaccgctacaa 329
>gnl|LJGI|TC75160 weakly similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5
scaffold_67, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr5 scaffold_67, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (10%)
Length = 523
Score = 113 bits (57), Expect = 3e-24
Identities = 87/97 (89%)
Strand = Plus / Plus
Query: 192 caggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctggaatctcct 251
||||||||||||||||| |||| || | |||| |||||||||||||||||||| |||
Sbjct: 180 caggcttccggtgaagttcctctcgcaactccgctgcgtctgcaagtcctggaacgccct 239
Query: 252 gatttccgatcccaaattcgccagaaggcaccttcgc 288
||||||||||||||||||||||||||||||||||||
Sbjct: 240 aatttccgatcccaaattcgccagaaggcaccttcgc 276
>gnl|LJGI|AV423520 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (15%)
Length = 468
Score = 79.8 bits (40), Expect = 4e-14
Identities = 148/184 (80%)
Strand = Plus / Plus
Query: 63 gttcaccacctccaccggaaccctaacatcaccttcgctcccttcctcttccaactctcc 122
|||||| || ||||||| | |||||||| ||||||| | ||||||||||||||| |||
Sbjct: 68 gttcacaacttccaccgaagccctaacaccaccttcatttccttcctcttccaaccctca 127
Query: 123 cggcggtgaccttcgtccgccgctgacacttcccacacttccattcgagctcatggaagt 182
||||| |||| ||||||| | | || || || ||||| ||||||||| ||| |
Sbjct: 128 cggcgactcacttcacccgccgccgccgctgccaacccttccgttcgagctcgtggtgga 187
Query: 183 tatcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctg 242
||||| |||||||| || |||||||| ||||||| |||||| ||||| |||||||||||
Sbjct: 188 aatcctatgcaggctccccgtgaagtccctcttgcaattccgctgcgtatgcaagtcctg 247
Query: 243 gaat 246
||||
Sbjct: 248 gaat 251
>gnl|LJGI|BP079620 similar to UniRef100_A7Q9Q0 Cluster: Chromosome chr5 scaffold_67,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr5 scaffold_67, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (6%)
Length = 355
Score = 77.8 bits (39), Expect = 1e-13
Identities = 51/55 (92%)
Strand = Plus / Minus
Query: 903 ggatgtttgggtcatgaaggagcatggaaataatgagtcatggacaagattgttc 957
|||||||||||| ||||||||| |||||||||||||||||||||| | |||||||
Sbjct: 352 ggatgtttgggttatgaaggagtatggaaataatgagtcatggactaaattgttc 298
>gnl|LJGI|TC76533 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (9%)
Length = 474
Score = 69.9 bits (35), Expect = 4e-11
Identities = 77/91 (84%)
Strand = Plus / Plus
Query: 184 atcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctgg 243
||||||||||| || |||||||| || ||||||| |||||| ||||| ||||| ||||||
Sbjct: 196 atcctctgcagactcccggtgaattccctcttgcaattccgctgcgtatgcaaatcctgg 255
Query: 244 aatctcctgatttccgatcccaaattcgcca 274
||| || || |||||||||||||| ||||
Sbjct: 256 aattctctcatctccgatcccaaatttgcca 286
>gnl|LJGI|DC593954 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (9%)
Length = 574
Score = 65.9 bits (33), Expect = 6e-10
Identities = 84/101 (83%)
Strand = Plus / Plus
Query: 184 atcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctgg 243
||||| |||||||| ||||||||| | || |||||||||| | ||| ||||||||||||
Sbjct: 77 atcctgtgcaggctcccggtgaagccgctgctgcgattccgctccgtttgcaagtcctgg 136
Query: 244 aatctcctgatttccgatcccaaattcgccagaaggcacct 284
||| ||| || |||||||||| ||||||| || ||||||
Sbjct: 137 aattccctaatctccgatcccatgttcgccaaaatgcacct 177
>gnl|LJGI|FS318183 weakly similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5
scaffold_67, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr5 scaffold_67, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (11%)
Length = 790
Score = 63.9 bits (32), Expect = 2e-09
Identities = 47/52 (90%)
Strand = Plus / Plus
Query: 194 ggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctggaa 245
|||||||||||||| |||| ||||||||||||||||| | |||||| |||||
Sbjct: 100 ggcttccggtgaagactctgttgcgattccggtgcgtgtccaagtcatggaa 151
>gnl|LJGI|TC65255 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (8%)
Length = 703
Score = 61.9 bits (31), Expect = 9e-09
Identities = 79/95 (83%)
Strand = Plus / Plus
Query: 190 tgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctggaatctc 249
||||||||||| ||||| || ||||||| | |||| ||||| |||||||| ||||| |
Sbjct: 189 tgcaggcttcctgtgaaatccctcttgcaactccgctgcgtatgcaagtcatggaaaacc 248
Query: 250 ctgatttccgatcccaaattcgccagaaggcacct 284
|| || ||||||||| ||||||||| || ||||||
Sbjct: 249 ctaatctccgatcccgaattcgccaaaacgcacct 283
>gnl|LJGI|DC595381 weakly similar to UniRef100_Q2HS67 Cluster: Cyclin-like F-box;
F-box protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (9%)
Length = 408
Score = 56.0 bits (28), Expect = 5e-07
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 230 tctgcaagtcctggaatctcctgatttccgatcccaaattcgccagaa 277
|||| |||||||||||| ||| || ||||||||||||||||||||||
Sbjct: 177 tctgaaagtcctggaattccctcatctccgatcccaaattcgccagaa 224
>gnl|LJGI|BP049904
Length = 541
Score = 54.0 bits (27), Expect = 2e-06
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 908 tttgggtcatgaaggagcatggaaataatgagtcatggacaagattgttca 958
||||||| ||||||||| |||| |||| |||||||||||| | ||||||||
Sbjct: 394 tttgggttatgaaggagtatgggaatagtgagtcatggactaaattgttca 344
>gnl|LJGI|TC77565 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (19%)
Length = 803
Score = 54.0 bits (27), Expect = 2e-06
Identities = 75/91 (82%)
Strand = Plus / Plus
Query: 184 atcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctgg 243
||||| |||||||| || ||||| || || |||| | |||| ||||| ||||||||||||
Sbjct: 140 atcctatgcaggctcccagtgaaatcgctgttgcaactccgctgcgtttgcaagtcctgg 199
Query: 244 aatctcctgatttccgatcccaaattcgcca 274
|| || || |||||||||||||||||||
Sbjct: 200 aaatcgctaatctccgatcccaaattcgcca 230
>gnl|LJGI|TC75940 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (9%)
Length = 585
Score = 54.0 bits (27), Expect = 2e-06
Identities = 75/91 (82%)
Strand = Plus / Plus
Query: 184 atcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctgg 243
||||||||||| || |||||||| || ||||||||| | || ||||| ||||| || |||
Sbjct: 331 atcctctgcagactcccggtgaattccctcttgcgactgcgctgcgtatgcaaatcatgg 390
Query: 244 aatctcctgatttccgatcccaaattcgcca 274
||| || || |||||||||||||| ||||
Sbjct: 391 aattctctaatctccgatcccaaatttgcca 421
>gnl|LJGI|TC82797 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (9%)
Length = 1418
Score = 52.0 bits (26), Expect = 8e-06
Identities = 53/62 (85%)
Strand = Plus / Plus
Query: 184 atcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctgg 243
||||||||||| || ||||| ||| | ||||||| |||||| ||||| ||||| ||||||
Sbjct: 217 atcctctgcagactcccggtaaagcccctcttgcaattccgctgcgtatgcaaatcctgg 276
Query: 244 aa 245
||
Sbjct: 277 aa 278
>gnl|LJGI|TC60928
Length = 1186
Score = 52.0 bits (26), Expect = 8e-06
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 846 cacattgggagtgttgagagattgcttgtg 875
|||||||||||||||| |||||||||||||
Sbjct: 616 cacattgggagtgttgcgagattgcttgtg 645