Miyakogusa Predicted Gene

Lj2g3v0632410.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0632410.1 tr|G7JX91|G7JX91_MEDTR F-box/kelch-repeat protein
OS=Medicago truncatula GN=MTR_5g057710 PE=4 SV=1,33.33,0.028,seg,NULL;
SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL; F-box,F-box domain,
cyclin-like; F_box_as,CUFF.34949.1
         (1221 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS328144 similar to UniRef100_A7Q9Q9 Cluster: Chromosom...   922   0.0  
gnl|LJGI|TC74128 similar to UniRef100_A7Q9Q9 Cluster: Chromosome...   172   3e-42
gnl|LJGI|TC75160 weakly similar to UniRef100_A7Q9Q9 Cluster: Chr...   113   3e-24
gnl|LJGI|AV423520 similar to UniRef100_Q2HWB4 Cluster: Cyclin-li...    80   4e-14
gnl|LJGI|BP079620 similar to UniRef100_A7Q9Q0 Cluster: Chromosom...    78   1e-13
gnl|LJGI|TC76533 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik...    70   4e-11
gnl|LJGI|DC593954 similar to UniRef100_Q2HWB4 Cluster: Cyclin-li...    66   6e-10
gnl|LJGI|FS318183 weakly similar to UniRef100_A7Q9Q9 Cluster: Ch...    64   2e-09
gnl|LJGI|TC65255 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik...    62   9e-09
gnl|LJGI|DC595381 weakly similar to UniRef100_Q2HS67 Cluster: Cy...    56   5e-07
gnl|LJGI|BP049904                                                      54   2e-06
gnl|LJGI|TC77565 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik...    54   2e-06
gnl|LJGI|TC75940 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik...    54   2e-06
gnl|LJGI|TC82797 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik...    52   8e-06
gnl|LJGI|TC60928                                                       52   8e-06

>gnl|LJGI|FS328144 similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5 scaffold_67,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr5 scaffold_67, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (9%)
          Length = 760

 Score =  922 bits (465), Expect = 0.0
 Identities = 468/469 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcaccaggtggtgacacgaacgacggtgttttcccaactccatcacggaagactcag 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 292 atggcaccaggtggtgacacgaacgacggtgttttcccaactccatcacggaagactcag 351

                                                                       
Query: 61  cggttcaccacctccaccggaaccctaacatcaccttcgctcccttcctcttccaactct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 352 cggttcaccacctccaccggaaccctaacatcaccttcgctcccttcctcttccaactct 411

                                                                       
Query: 121 cccggcggtgaccttcgtccgccgctgacacttcccacacttccattcgagctcatggaa 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 412 cccggcggtgaccttcgtccgccgctgacacttcccacacttccattcgagctcatggaa 471

                                                                       
Query: 181 gttatcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 472 gttatcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcc 531

                                                                       
Query: 241 tggaatctcctgatttccgatcccaaattcgccagaaggcaccttcgcgagttcaaccgc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 532 tggaatctcctgatttccgatcccaaattcgccagaaggcaccttcgcgagttcaaccgc 591

                                                                       
Query: 301 tacaatctcattgtaaaatccaggaaccatgtcaactcttattcacacagctccaccact 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 592 tacaatctcattgtaaaatccaggaaccatgtcaactcttattcacacagctccaccact 651

                                                                       
Query: 361 ttcaacaacacaatgattctcagctcgacgcggctagagtaccctctcaaccgcgatatc 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 652 ttcaacaacacaatgattctcagctcgacgcggctagagtaccctctcaaccgcgatatc 711

                                                            
Query: 421 cgtaacgatcttgttggctcgtgcgatggtatgctctgtttctgcgccc 469
           ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 712 cgtaacgatctcgttggctcgtgcgatggtatgctctgtttctgcgccc 760


>gnl|LJGI|TC74128 similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5 scaffold_67,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr5 scaffold_67, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (9%)
          Length = 501

 Score =  172 bits (87), Expect = 3e-42
 Identities = 138/155 (89%)
 Strand = Plus / Plus

                                                                       
Query: 151 cttcccacacttccattcgagctcatggaagttatcctctgcaggcttccggtgaagtct 210
           ||||| || ||| ||| ||||||| ||||||  ||||| || ||| ||||||||||||||
Sbjct: 175 cttccaacccttgcatccgagctcgtggaagaaatcctatgtagggttccggtgaagtct 234

                                                                       
Query: 211 ctcttgcgattccggtgcgtctgcaagtcctggaatctcctgatttccgatcccaaattc 270
           || |||||||||||||||||||||||||||||||||  ||||||||| ||||||||||||
Sbjct: 235 cttttgcgattccggtgcgtctgcaagtcctggaattccctgatttctgatcccaaattc 294

                                              
Query: 271 gccagaaggcaccttcgcgagttcaaccgctacaa 305
           ||||||| ||||| |||||||| ||||||||||||
Sbjct: 295 gccagaaagcaccgtcgcgagtacaaccgctacaa 329


>gnl|LJGI|TC75160 weakly similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5
           scaffold_67, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr5 scaffold_67, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (10%)
          Length = 523

 Score =  113 bits (57), Expect = 3e-24
 Identities = 87/97 (89%)
 Strand = Plus / Plus

                                                                       
Query: 192 caggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctggaatctcct 251
           |||||||||||||||||  |||| || | |||| ||||||||||||||||||||   |||
Sbjct: 180 caggcttccggtgaagttcctctcgcaactccgctgcgtctgcaagtcctggaacgccct 239

                                                
Query: 252 gatttccgatcccaaattcgccagaaggcaccttcgc 288
            ||||||||||||||||||||||||||||||||||||
Sbjct: 240 aatttccgatcccaaattcgccagaaggcaccttcgc 276


>gnl|LJGI|AV423520 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (15%)
          Length = 468

 Score = 79.8 bits (40), Expect = 4e-14
 Identities = 148/184 (80%)
 Strand = Plus / Plus

                                                                       
Query: 63  gttcaccacctccaccggaaccctaacatcaccttcgctcccttcctcttccaactctcc 122
           |||||| || ||||||| | |||||||| |||||||  | ||||||||||||||| ||| 
Sbjct: 68  gttcacaacttccaccgaagccctaacaccaccttcatttccttcctcttccaaccctca 127

                                                                       
Query: 123 cggcggtgaccttcgtccgccgctgacacttcccacacttccattcgagctcatggaagt 182
           |||||     ||||  ||||||| | | || || || ||||| ||||||||| |||  | 
Sbjct: 128 cggcgactcacttcacccgccgccgccgctgccaacccttccgttcgagctcgtggtgga 187

                                                                       
Query: 183 tatcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctg 242
            ||||| |||||||| || |||||||| ||||||| |||||| ||||| |||||||||||
Sbjct: 188 aatcctatgcaggctccccgtgaagtccctcttgcaattccgctgcgtatgcaagtcctg 247

               
Query: 243 gaat 246
           ||||
Sbjct: 248 gaat 251


>gnl|LJGI|BP079620 similar to UniRef100_A7Q9Q0 Cluster: Chromosome chr5 scaffold_67,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr5 scaffold_67, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (6%)
          Length = 355

 Score = 77.8 bits (39), Expect = 1e-13
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 903 ggatgtttgggtcatgaaggagcatggaaataatgagtcatggacaagattgttc 957
           |||||||||||| ||||||||| |||||||||||||||||||||| | |||||||
Sbjct: 352 ggatgtttgggttatgaaggagtatggaaataatgagtcatggactaaattgttc 298


>gnl|LJGI|TC76533 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (9%)
          Length = 474

 Score = 69.9 bits (35), Expect = 4e-11
 Identities = 77/91 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 atcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctgg 243
           ||||||||||| || |||||||| || ||||||| |||||| ||||| ||||| ||||||
Sbjct: 196 atcctctgcagactcccggtgaattccctcttgcaattccgctgcgtatgcaaatcctgg 255

                                          
Query: 244 aatctcctgatttccgatcccaaattcgcca 274
           |||   || || |||||||||||||| ||||
Sbjct: 256 aattctctcatctccgatcccaaatttgcca 286


>gnl|LJGI|DC593954 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (9%)
          Length = 574

 Score = 65.9 bits (33), Expect = 6e-10
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 184 atcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctgg 243
           ||||| |||||||| ||||||||| | ||  |||||||||| | ||| ||||||||||||
Sbjct: 77  atcctgtgcaggctcccggtgaagccgctgctgcgattccgctccgtttgcaagtcctgg 136

                                                    
Query: 244 aatctcctgatttccgatcccaaattcgccagaaggcacct 284
           |||  ||| || ||||||||||  ||||||| || ||||||
Sbjct: 137 aattccctaatctccgatcccatgttcgccaaaatgcacct 177


>gnl|LJGI|FS318183 weakly similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5
           scaffold_67, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr5 scaffold_67, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (11%)
          Length = 790

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 194 ggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctggaa 245
           |||||||||||||| |||| ||||||||||||||||| | |||||| |||||
Sbjct: 100 ggcttccggtgaagactctgttgcgattccggtgcgtgtccaagtcatggaa 151


>gnl|LJGI|TC65255 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (8%)
          Length = 703

 Score = 61.9 bits (31), Expect = 9e-09
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 190 tgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctggaatctc 249
           ||||||||||| ||||| || ||||||| | |||| ||||| |||||||| |||||   |
Sbjct: 189 tgcaggcttcctgtgaaatccctcttgcaactccgctgcgtatgcaagtcatggaaaacc 248

                                              
Query: 250 ctgatttccgatcccaaattcgccagaaggcacct 284
           || || ||||||||| ||||||||| || ||||||
Sbjct: 249 ctaatctccgatcccgaattcgccaaaacgcacct 283


>gnl|LJGI|DC595381 weakly similar to UniRef100_Q2HS67 Cluster: Cyclin-like F-box;
           F-box protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (9%)
          Length = 408

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 230 tctgcaagtcctggaatctcctgatttccgatcccaaattcgccagaa 277
           |||| ||||||||||||  ||| || ||||||||||||||||||||||
Sbjct: 177 tctgaaagtcctggaattccctcatctccgatcccaaattcgccagaa 224


>gnl|LJGI|BP049904 
          Length = 541

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 908 tttgggtcatgaaggagcatggaaataatgagtcatggacaagattgttca 958
           ||||||| ||||||||| |||| |||| |||||||||||| | ||||||||
Sbjct: 394 tttgggttatgaaggagtatgggaatagtgagtcatggactaaattgttca 344


>gnl|LJGI|TC77565 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (19%)
          Length = 803

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                       
Query: 184 atcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctgg 243
           ||||| |||||||| || ||||| || || |||| | |||| ||||| ||||||||||||
Sbjct: 140 atcctatgcaggctcccagtgaaatcgctgttgcaactccgctgcgtttgcaagtcctgg 199

                                          
Query: 244 aatctcctgatttccgatcccaaattcgcca 274
           ||    || || |||||||||||||||||||
Sbjct: 200 aaatcgctaatctccgatcccaaattcgcca 230


>gnl|LJGI|TC75940 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (9%)
          Length = 585

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                       
Query: 184 atcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctgg 243
           ||||||||||| || |||||||| || ||||||||| | || ||||| ||||| || |||
Sbjct: 331 atcctctgcagactcccggtgaattccctcttgcgactgcgctgcgtatgcaaatcatgg 390

                                          
Query: 244 aatctcctgatttccgatcccaaattcgcca 274
           |||   || || |||||||||||||| ||||
Sbjct: 391 aattctctaatctccgatcccaaatttgcca 421


>gnl|LJGI|TC82797 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (9%)
          Length = 1418

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 184 atcctctgcaggcttccggtgaagtctctcttgcgattccggtgcgtctgcaagtcctgg 243
           ||||||||||| || ||||| ||| | ||||||| |||||| ||||| ||||| ||||||
Sbjct: 217 atcctctgcagactcccggtaaagcccctcttgcaattccgctgcgtatgcaaatcctgg 276

             
Query: 244 aa 245
           ||
Sbjct: 277 aa 278


>gnl|LJGI|TC60928 
          Length = 1186

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 846 cacattgggagtgttgagagattgcttgtg 875
           |||||||||||||||| |||||||||||||
Sbjct: 616 cacattgggagtgttgcgagattgcttgtg 645