Miyakogusa Predicted Gene

Lj2g3v0483910.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0483910.1 Non Chatacterized Hit- tr|I1MQ68|I1MQ68_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,71.43,0,seg,NULL; no
description,Chloramphenicol acetyltransferase-like domain;
Transferase,Transferase; SUB,CUFF.34628.1
         (514 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV409320 similar to UniRef100_Q8GT20 Cluster: Benzoyl c...   103   1e-21
gnl|LJGI|FS341231 similar to UniRef100_Q8GT20 Cluster: Benzoyl c...    76   2e-13

>gnl|LJGI|AV409320 similar to UniRef100_Q8GT20 Cluster: Benzoyl coenzyme A: benzyl
           alcohol benzoyl transferase; n=1; Nicotiana tabacum|Rep:
           Benzoyl coenzyme A: benzyl alcohol benzoyl transferase -
           Nicotiana tabacum (Common tobacco), partial (28%)
          Length = 392

 Score =  103 bits (52), Expect = 1e-21
 Identities = 168/206 (81%), Gaps = 3/206 (1%)
 Strand = Plus / Plus

                                                                       
Query: 247 ttctaccgctaccatccattgatggcagggaaagaccctgttcaggttattagacaagca 306
           ||||| |||||| ||||||  ||||||||||| ||||||||| | |  |||||| |||||
Sbjct: 111 ttctatcgctacaatccatctatggcagggaaggaccctgttgatgccattagaaaagca 170

                                                                       
Query: 307 cttgccaaaacacttgtgttttactacccgttcgcaggaagaattaggaaaggtcctagt 366
            | ||||||||||||||||||||||| || || ||||| ||  | ||| |||| ||   |
Sbjct: 171 ttggccaaaacacttgtgttttactatccctttgcaggtaggctaagggaagggcc---t 227

                                                                       
Query: 367 ggtaacaaactaatggtggattgtaatgaagaaggtgtcatgttcattgaagccgatgca 426
           ||||  ||||| ||||||||||| | || |||||||||  | ||||||||||||||||||
Sbjct: 228 ggtaggaaactcatggtggattgcactgcagaaggtgttttattcattgaagccgatgca 287

                                     
Query: 427 gatgttacacttgaacaatttggtga 452
           ||||| || ||| |  ||||||||||
Sbjct: 288 gatgtcactcttaacgaatttggtga 313


>gnl|LJGI|FS341231 similar to UniRef100_Q8GT20 Cluster: Benzoyl coenzyme A: benzyl
           alcohol benzoyl transferase; n=1; Nicotiana tabacum|Rep:
           Benzoyl coenzyme A: benzyl alcohol benzoyl transferase -
           Nicotiana tabacum (Common tobacco), partial (44%)
          Length = 669

 Score = 75.8 bits (38), Expect = 2e-13
 Identities = 74/86 (86%)
 Strand = Plus / Plus

                                                                       
Query: 247 ttctaccgctaccatccattgatggcagggaaagaccctgttcaggttattagacaagca 306
           |||||||||||  ||||||  ||||||||||| ||||||||| |||  |||||| | |||
Sbjct: 194 ttctaccgctatgatccatcaatggcagggaaggaccctgttgaggccattagaaaggca 253

                                     
Query: 307 cttgccaaaacacttgtgttttacta 332
            | |||||||||||||||||||||||
Sbjct: 254 ttggccaaaacacttgtgttttacta 279