Miyakogusa Predicted Gene
- Lj2g3v0483910.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v0483910.1 Non Chatacterized Hit- tr|I1MQ68|I1MQ68_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,71.43,0,seg,NULL; no
description,Chloramphenicol acetyltransferase-like domain;
Transferase,Transferase; SUB,CUFF.34628.1
(514 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AV409320 similar to UniRef100_Q8GT20 Cluster: Benzoyl c... 103 1e-21
gnl|LJGI|FS341231 similar to UniRef100_Q8GT20 Cluster: Benzoyl c... 76 2e-13
>gnl|LJGI|AV409320 similar to UniRef100_Q8GT20 Cluster: Benzoyl coenzyme A: benzyl
alcohol benzoyl transferase; n=1; Nicotiana tabacum|Rep:
Benzoyl coenzyme A: benzyl alcohol benzoyl transferase -
Nicotiana tabacum (Common tobacco), partial (28%)
Length = 392
Score = 103 bits (52), Expect = 1e-21
Identities = 168/206 (81%), Gaps = 3/206 (1%)
Strand = Plus / Plus
Query: 247 ttctaccgctaccatccattgatggcagggaaagaccctgttcaggttattagacaagca 306
||||| |||||| |||||| ||||||||||| ||||||||| | | |||||| |||||
Sbjct: 111 ttctatcgctacaatccatctatggcagggaaggaccctgttgatgccattagaaaagca 170
Query: 307 cttgccaaaacacttgtgttttactacccgttcgcaggaagaattaggaaaggtcctagt 366
| ||||||||||||||||||||||| || || ||||| || | ||| |||| || |
Sbjct: 171 ttggccaaaacacttgtgttttactatccctttgcaggtaggctaagggaagggcc---t 227
Query: 367 ggtaacaaactaatggtggattgtaatgaagaaggtgtcatgttcattgaagccgatgca 426
|||| ||||| ||||||||||| | || ||||||||| | ||||||||||||||||||
Sbjct: 228 ggtaggaaactcatggtggattgcactgcagaaggtgttttattcattgaagccgatgca 287
Query: 427 gatgttacacttgaacaatttggtga 452
||||| || ||| | ||||||||||
Sbjct: 288 gatgtcactcttaacgaatttggtga 313
>gnl|LJGI|FS341231 similar to UniRef100_Q8GT20 Cluster: Benzoyl coenzyme A: benzyl
alcohol benzoyl transferase; n=1; Nicotiana tabacum|Rep:
Benzoyl coenzyme A: benzyl alcohol benzoyl transferase -
Nicotiana tabacum (Common tobacco), partial (44%)
Length = 669
Score = 75.8 bits (38), Expect = 2e-13
Identities = 74/86 (86%)
Strand = Plus / Plus
Query: 247 ttctaccgctaccatccattgatggcagggaaagaccctgttcaggttattagacaagca 306
||||||||||| |||||| ||||||||||| ||||||||| ||| |||||| | |||
Sbjct: 194 ttctaccgctatgatccatcaatggcagggaaggaccctgttgaggccattagaaaggca 253
Query: 307 cttgccaaaacacttgtgttttacta 332
| |||||||||||||||||||||||
Sbjct: 254 ttggccaaaacacttgtgttttacta 279