Miyakogusa Predicted Gene

Lj2g3v0435480.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0435480.1 CUFF.34573.1
         (301 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW600244 similar to UniRef100_Q4AFR6 Cluster: Biotin/li...   117   4e-26

>gnl|LJGI|BW600244 similar to UniRef100_Q4AFR6 Cluster: Biotin/lipoyl attachment; n=1;
           Chlorobium phaeobacteroides BS1|Rep: Biotin/lipoyl
           attachment - Chlorobium phaeobacteroides BS1, partial
           (7%)
          Length = 470

 Score =  117 bits (59), Expect = 4e-26
 Identities = 77/83 (92%)
 Strand = Plus / Minus

                                                                       
Query: 35  gtttttcatccttgaatgtgttgccgtcggtcaagttagtccttggttgtgttttccgtt 94
           ||||||||||| |||||||||||||||||||||||||  |||||||||| ||||||||||
Sbjct: 467 gtttttcatccctgaatgtgttgccgtcggtcaagttcatccttggttgagttttccgtt 408

                                  
Query: 95  ggtccctcagacggaaaagtcca 117
            |||||| |||||||||||||||
Sbjct: 407 agtccctgagacggaaaagtcca 385