Miyakogusa Predicted Gene
- Lj2g3v0286940.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v0286940.1 Non Chatacterized Hit- tr|I1MPU3|I1MPU3_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.20126
PE,70.61,0,seg,NULL; Myb_DNA-binding,SANT/Myb domain; no
description,Homeodomain-like; MYB DNA BINDING / TRANSC,CUFF.34469.1
(828 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|DC599750 similar to UniRef100_Q0PJC8 Cluster: MYB trans... 674 0.0
gnl|LJGI|FS342933 similar to UniRef100_Q0PJC8 Cluster: MYB trans... 287 5e-77
gnl|LJGI|GO012249 homologue to UniRef100_Q0PJD8 Cluster: MYB tra... 60 2e-08
gnl|LJGI|GO032081 homologue to UniRef100_Q09GS2 Cluster: Transcr... 52 6e-06
>gnl|LJGI|DC599750 similar to UniRef100_Q0PJC8 Cluster: MYB transcription factor
MYB94; n=1; Glycine max|Rep: MYB transcription factor
MYB94 - Glycine max (Soybean), partial (82%)
Length = 540
Score = 674 bits (340), Expect = 0.0
Identities = 340/340 (100%)
Strand = Plus / Plus
Query: 1 atgggggtccagttacaggaaaaaacaaagccaaaatacagaaagggtttatggtcacct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 atgggggtccagttacaggaaaaaacaaagccaaaatacagaaagggtttatggtcacct 260
Query: 61 gaggaagataataagctcagaaactatatccttaaccatggtcatggctgctggagctct 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 gaggaagataataagctcagaaactatatccttaaccatggtcatggctgctggagctct 320
Query: 121 gtccccattaaggcaggattgcaaaggaatggaaagagctgcagactaaggtggatcaat 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 gtccccattaaggcaggattgcaaaggaatggaaagagctgcagactaaggtggatcaat 380
Query: 181 tacctgaggccaggactaaagagaggggtattcagcaaacatgaggaggatacaatcatg 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 tacctgaggccaggactaaagagaggggtattcagcaaacatgaggaggatacaatcatg 440
Query: 241 acccttcaccacatgttgggtaacaagtggtctcagatatcacagcatttgccaggaagg 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 acccttcaccacatgttgggtaacaagtggtctcagatatcacagcatttgccaggaagg 500
Query: 301 actgacaatgagataaaaaactactggcattcatatttga 340
||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 actgacaatgagataaaaaactactggcattcatatttga 540
>gnl|LJGI|FS342933 similar to UniRef100_Q0PJC8 Cluster: MYB transcription factor
MYB94; n=1; Glycine max|Rep: MYB transcription factor
MYB94 - Glycine max (Soybean), complete
Length = 773
Score = 287 bits (145), Expect = 5e-77
Identities = 325/385 (84%)
Strand = Plus / Plus
Query: 26 caaagccaaaatacagaaagggtttatggtcacctgaggaagataataagctcagaaact 85
|||| |||||| |||| || || ||||||||||| || ||||| | || || |||||||
Sbjct: 200 caaaaccaaaacacaggaaagggttatggtcaccagaagaagaccacaaacttagaaact 259
Query: 86 atatccttaaccatggtcatggctgctggagctctgtccccattaaggcaggattgcaaa 145
|||||||||| ||||||||||| || |||||||||||||||||||| ||||| |||||||
Sbjct: 260 atatccttaagcatggtcatggatgttggagctctgtccccattaatgcagggttgcaaa 319
Query: 146 ggaatggaaagagctgcagactaaggtggatcaattacctgaggccaggactaaagagag 205
||||||||||||| |||||||| ||||||||||| || || ||||||||| | |||||||
Sbjct: 320 ggaatggaaagagttgcagactgaggtggatcaactatctaaggccaggattgaagagag 379
Query: 206 gggtattcagcaaacatgaggaggatacaatcatgacccttcaccacatgttgggtaaca 265
|| ||| |||||| || ||||| ||||||| |||||||| ||||||| || ||||
Sbjct: 380 ggaggctcaacaaacaggaagaggagacaatcactacccttcatgacatgttaggcaaca 439
Query: 266 agtggtctcagatatcacagcatttgccaggaaggactgacaatgagataaaaaactact 325
||||||| |||||| |||| ||||| ||||||||||| |||||||| || ||||||||||
Sbjct: 440 agtggtcacagatagcacaacatttaccaggaaggacagacaatgaaattaaaaactact 499
Query: 326 ggcattcatatttgaaaaagaaagtactcaaacctcatgaaatggaacctcatagccaaa 385
||||||||||||||||||||| ||| |||| | | ||| ||||| ||||| ||||
Sbjct: 500 ggcattcatatttgaaaaagagagtggccaaagcaaaggaattggaatttcataaacaaa 559
Query: 386 ctcagcatgctagctcaagctcaga 410
||| ||||||||||||||||||||
Sbjct: 560 ttcaacatgctagctcaagctcaga 584
Score = 83.8 bits (42), Expect = 2e-15
Identities = 54/58 (93%)
Strand = Plus / Plus
Query: 548 cttctcaaagctccttaccaaaactgctatttgctgagtggctttcagtggagcatgt 605
|||||||||||||||||||||||||| |||||||||| ||||||||| |||| |||||
Sbjct: 659 cttctcaaagctccttaccaaaactgttatttgctgaatggctttcactggatcatgt 716
>gnl|LJGI|GO012249 homologue to UniRef100_Q0PJD8 Cluster: MYB transcription factor
MYB187; n=1; Glycine max|Rep: MYB transcription factor
MYB187 - Glycine max (Soybean), partial (50%)
Length = 756
Score = 60.0 bits (30), Expect = 2e-08
Identities = 39/42 (92%)
Strand = Plus / Plus
Query: 154 aagagctgcagactaaggtggatcaattacctgaggccagga 195
|||||||||||||| || |||| |||||||||||||||||||
Sbjct: 264 aagagctgcagacttagatggaccaattacctgaggccagga 305
>gnl|LJGI|GO032081 homologue to UniRef100_Q09GS2 Cluster: Transcription factor MYBJ7;
n=1; Glycine max|Rep: Transcription factor MYBJ7 -
Glycine max (Soybean), partial (51%)
Length = 653
Score = 52.0 bits (26), Expect = 6e-06
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 290 tgccaggaaggactgacaatgagataaaaaactactgg 327
||||||| |||||||||||||| ||||| |||||||||
Sbjct: 493 tgccagggaggactgacaatgatataaagaactactgg 530