Miyakogusa Predicted Gene

Lj2g3v0126180.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0126180.1 Non Chatacterized Hit- tr|I1MIK6|I1MIK6_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.20953
PE,55.56,4e-17,seg,NULL,NODE_51528_length_470_cov_219.578720.path1.1
         (301 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59667 similar to UniRef100_Q1L0Q8 Cluster: At3g12480-...   597   e-170
gnl|LJGI|TC69899 similar to UniRef100_Q1L0Q8 Cluster: At3g12480-...   105   2e-22

>gnl|LJGI|TC59667 similar to UniRef100_Q1L0Q8 Cluster: At3g12480-like protein; n=1;
            Boechera stricta|Rep: At3g12480-like protein - Boechera
            drummondii (Rock-cress) (Arabis drummondii), partial
            (38%)
          Length = 1401

 Score =  597 bits (301), Expect = e-170
 Identities = 301/301 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgacaatacatgatagttcagagacaaaggagttaccaaaggagaacgctgcagttcct 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 731  atgacaatacatgatagttcagagacaaaggagttaccaaaggagaacgctgcagttcct 790

                                                                        
Query: 61   gctgaaagcgcagagttccataatcttgatctgaatgccaacaccaacgaaaacgaggac 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 791  gctgaaagcgcagagttccataatcttgatctgaatgccaacaccaacgaaaacgaggac 850

                                                                        
Query: 121  aaaaaggcaagcacaacagctaaacaggagatatcagaacctccaacagagagccagcat 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 851  aaaaaggcaagcacaacagctaaacaggagatatcagaacctccaacagagagccagcat 910

                                                                        
Query: 181  gaagaaattccgggttggtcactatcagatgtggacaagatggctattgactctgtgcag 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 911  gaagaaattccgggttggtcactatcagatgtggacaagatggctattgactctgtgcag 970

                                                                        
Query: 241  cttgcaaaccttggtacgcacatagaagaggatgaagaagattatgatgaggaagggtaa 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 971  cttgcaaaccttggtacgcacatagaagaggatgaagaagattatgatgaggaagggtaa 1030

             
Query: 301  a 301
            |
Sbjct: 1031 a 1031


>gnl|LJGI|TC69899 similar to UniRef100_Q1L0Q8 Cluster: At3g12480-like protein; n=1;
            Boechera stricta|Rep: At3g12480-like protein - Boechera
            drummondii (Rock-cress) (Arabis drummondii), partial
            (50%)
          Length = 1437

 Score =  105 bits (53), Expect = 2e-22
 Identities = 106/121 (87%), Gaps = 2/121 (1%)
 Strand = Plus / Plus

                                                                        
Query: 181  gaagaaattccgggttggtcactatcagatgtggacaagatggctattgactctgtgcag 240
            ||||||||||| || ||||| || || || |||||||||||||| ||||||  | |||||
Sbjct: 955  gaagaaattcccggctggtccctttctgacgtggacaagatggccattgacaatatgcag 1014

                                                                        
Query: 241  cttgcaaaccttggtacgcaca-tagaagaggatgaagaagattatgatgaggaagggta 299
            |||||||||||||||| | | | ||||||| |||||||||||||||||||||||||||||
Sbjct: 1015 cttgcaaaccttggta-gtagagtagaagatgatgaagaagattatgatgaggaagggta 1073

             
Query: 300  a 300
            |
Sbjct: 1074 a 1074