Miyakogusa Predicted Gene
- Lj2g3v0126180.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v0126180.1 Non Chatacterized Hit- tr|I1MIK6|I1MIK6_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.20953
PE,55.56,4e-17,seg,NULL,NODE_51528_length_470_cov_219.578720.path1.1
(301 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC59667 similar to UniRef100_Q1L0Q8 Cluster: At3g12480-... 597 e-170
gnl|LJGI|TC69899 similar to UniRef100_Q1L0Q8 Cluster: At3g12480-... 105 2e-22
>gnl|LJGI|TC59667 similar to UniRef100_Q1L0Q8 Cluster: At3g12480-like protein; n=1;
Boechera stricta|Rep: At3g12480-like protein - Boechera
drummondii (Rock-cress) (Arabis drummondii), partial
(38%)
Length = 1401
Score = 597 bits (301), Expect = e-170
Identities = 301/301 (100%)
Strand = Plus / Plus
Query: 1 atgacaatacatgatagttcagagacaaaggagttaccaaaggagaacgctgcagttcct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 731 atgacaatacatgatagttcagagacaaaggagttaccaaaggagaacgctgcagttcct 790
Query: 61 gctgaaagcgcagagttccataatcttgatctgaatgccaacaccaacgaaaacgaggac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 791 gctgaaagcgcagagttccataatcttgatctgaatgccaacaccaacgaaaacgaggac 850
Query: 121 aaaaaggcaagcacaacagctaaacaggagatatcagaacctccaacagagagccagcat 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 851 aaaaaggcaagcacaacagctaaacaggagatatcagaacctccaacagagagccagcat 910
Query: 181 gaagaaattccgggttggtcactatcagatgtggacaagatggctattgactctgtgcag 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 911 gaagaaattccgggttggtcactatcagatgtggacaagatggctattgactctgtgcag 970
Query: 241 cttgcaaaccttggtacgcacatagaagaggatgaagaagattatgatgaggaagggtaa 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 971 cttgcaaaccttggtacgcacatagaagaggatgaagaagattatgatgaggaagggtaa 1030
Query: 301 a 301
|
Sbjct: 1031 a 1031
>gnl|LJGI|TC69899 similar to UniRef100_Q1L0Q8 Cluster: At3g12480-like protein; n=1;
Boechera stricta|Rep: At3g12480-like protein - Boechera
drummondii (Rock-cress) (Arabis drummondii), partial
(50%)
Length = 1437
Score = 105 bits (53), Expect = 2e-22
Identities = 106/121 (87%), Gaps = 2/121 (1%)
Strand = Plus / Plus
Query: 181 gaagaaattccgggttggtcactatcagatgtggacaagatggctattgactctgtgcag 240
||||||||||| || ||||| || || || |||||||||||||| |||||| | |||||
Sbjct: 955 gaagaaattcccggctggtccctttctgacgtggacaagatggccattgacaatatgcag 1014
Query: 241 cttgcaaaccttggtacgcaca-tagaagaggatgaagaagattatgatgaggaagggta 299
|||||||||||||||| | | | ||||||| |||||||||||||||||||||||||||||
Sbjct: 1015 cttgcaaaccttggta-gtagagtagaagatgatgaagaagattatgatgaggaagggta 1073
Query: 300 a 300
|
Sbjct: 1074 a 1074