Miyakogusa Predicted Gene

Lj1g3v5034710.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v5034710.1 Non Chatacterized Hit- tr|I1NCK6|I1NCK6_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.38948
PE,84.3,0,seg,NULL; FAMILY NOT NAMED,NULL; A_thal_3526,Conserved
hypothetical protein CHP01589, plant; A_thal_,CUFF.33897.1
         (1089 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81071 similar to UniRef100_A7PZU9 Cluster: Chromosome...   226   2e-58

>gnl|LJGI|TC81071 similar to UniRef100_A7PZU9 Cluster: Chromosome chr15 scaffold_40,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr15 scaffold_40, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (43%)
          Length = 735

 Score =  226 bits (114), Expect = 2e-58
 Identities = 382/471 (81%), Gaps = 9/471 (1%)
 Strand = Plus / Plus

                                                                        
Query: 578  gagtccctgcacctagcaacttccatcccattcggacgaattctgggaatggaatggtga 637
            ||||||||||||| ||||| || ||||||||||||| ||||||||||||||  |||||||
Sbjct: 1    gagtccctgcaccgagcaattttcatcccattcggatgaattctgggaatgacatggtga 60

                                                                        
Query: 638  tgaaccacagtgctcctgatataaaacctgttatcccaccaaacagtgcaatgtcatcct 697
            || ||||||| |||| | ||   |  ||    || ||||||||  ||| |||||||||| 
Sbjct: 61   tggaccacagcgctcgtaatgcgactccaacgattccaccaaatggtgtaatgtcatcc- 119

                                                                        
Query: 698  tatcagaaatgccagtgagtccagcatcggtagcatccagtggccatttccccttcactg 757
                 |||||||||||||||||  | ||   |||||||||||| ||||||||||||||||
Sbjct: 120  -----gaaatgccagtgagtccgacttc---agcatccagtggtcatttccccttcactg 171

                                                                        
Query: 758  gatcagacataccaggaatgggggcagatgcatctgctctggatgccgcatttgcatctg 817
             |||||| ||| ||||||||||  | |||||||| ||||| ||| |||||||| ||||||
Sbjct: 172  catcagaaatatcaggaatgggcacggatgcatcagctcttgataccgcatttacatctg 231

                                                                        
Query: 818  atttggcaagctctgccggactgcatcttgcaccagataatggcactgctattcccagat 877
            || ||||||| || |  ||||| || ||||||||||||    |||  |  ||| | ||||
Sbjct: 232  atgtggcaagttcaggaggactacaacttgcaccagatggcagcaacggaatttctagat 291

                                                                        
Query: 878  ccctcgatcaaatacagtggaattttagtctatctgatctaacagcagatttgtcaaact 937
            | ||||||||||| |||||||||||||| ||||||||||| |||||||||||| | ||||
Sbjct: 292  cgctcgatcaaattcagtggaattttagcctatctgatctgacagcagatttgcccaact 351

                                                                        
Query: 938  tgggagatcttggagctctgggaaactaccctggttcaccatttatgcagtctgattcgg 997
            ||||||| || |||||||| |||||||| ||||| ||||||||| |||  |||||||| |
Sbjct: 352  tgggagacctaggagctcttggaaactatcctggctcaccatttttgccatctgattctg 411

                                                               
Query: 998  atattttgatggaatcctcggatcaaaaggacatagtggatgacttctttg 1048
            | || ||| | || ||  | |||||| |||| ||||||||||| |||||||
Sbjct: 412  acatgttgctcgagtcaccagatcaacaggatatagtggatgatttctttg 462