Miyakogusa Predicted Gene

Lj1g3v5021150.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v5021150.1 Non Chatacterized Hit- tr|F6I675|F6I675_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,80.2,0,(Trans)glycosidases,Glycoside hydrolase, superfamily; no
description,Glycoside hydrolase, catalytic ,CUFF.33856.1
         (900 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74622 similar to UniRef100_P36908 Cluster: Acidic end...    58   1e-07
gnl|LJGI|TC66712 similar to UniRef100_Q9SC03 Cluster: Chitinase;...    58   1e-07

>gnl|LJGI|TC74622 similar to UniRef100_P36908 Cluster: Acidic endochitinase
           precursor; n=2; Cicer arietinum|Rep: Acidic
           endochitinase precursor - Cicer arietinum (Chickpea)
           (Garbanzo), partial (41%)
          Length = 515

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 584 tcaaaacaggcctttttgactatgtttgggttcaattctacaacaaccc 632
           |||||||||| ||||||||  |||| |||||||| ||||||||||||||
Sbjct: 80  tcaaaacagggctttttgatcatgtctgggttcagttctacaacaaccc 128


>gnl|LJGI|TC66712 similar to UniRef100_Q9SC03 Cluster: Chitinase; n=1; Trifolium
           repens|Rep: Chitinase - Trifolium repens (Creeping white
           clover), partial (90%)
          Length = 1103

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 421 gatgctgttttggatggcattgattttgacattgaac 457
           |||||||| ||||||||||||||||| ||||||||||
Sbjct: 454 gatgctgtgttggatggcattgatttcgacattgaac 490