Miyakogusa Predicted Gene

Lj1g3v4996200.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4996200.1 Non Chatacterized Hit- tr|I1NCA4|I1NCA4_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,80.14,0,Malectin_like,Malectin-like carbohydrate-binding domain;
Pkinase_Tyr,Serine-threonine/tyrosine-prote,CUFF.33910.1
         (2592 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78562 similar to UniRef100_A7U519 Cluster: FERONIA re...    68   3e-10
gnl|LJGI|TC72921 homologue to UniRef100_A7P1H0 Cluster: Chromoso...    62   2e-08
gnl|LJGI|BP042662 similar to UniRef100_Q94KF2 Cluster: Pto-like ...    60   7e-08

>gnl|LJGI|TC78562 similar to UniRef100_A7U519 Cluster: FERONIA receptor-like kinase;
            n=1; Arabidopsis lyrata|Rep: FERONIA receptor-like kinase
            - Arabidopsis lyrata (Lyre-leaved rock-cress), partial
            (53%)
          Length = 1878

 Score = 67.9 bits (34), Expect = 3e-10
 Identities = 136/170 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1850 catggaagcaaaggttggagatctgcattggatctgcaagaggccttcactaccttcaca 1909
            |||||||||||||| | ||||| ||||||||| ||||  | ||  | ||||| || || |
Sbjct: 766  catggaagcaaaggcttgagatatgcattggagctgctcggggtttacactatctacata 825

                                                                        
Query: 1910 caggagctaagtacacgatcattcatagagatgtcaaaacaactaacattctcttggatg 1969
            | || || || ||||| ||||| ||  ||||||| || || || ||||||||  | ||||
Sbjct: 826  ccggtgccaaatacactatcatccaccgagatgtgaagaccacaaacattctactagatg 885

                                                              
Query: 1970 agaactgggttgccaaggtttcagattttggcttgtcgaaaacaggtcct 2019
            |||| ||||| || |||||||| |||||||| ||||| ||||||||||||
Sbjct: 886  agaagtgggtggctaaggtttctgattttggattgtctaaaacaggtcct 935


>gnl|LJGI|TC72921 homologue to UniRef100_A7P1H0 Cluster: Chromosome chr19 scaffold_4,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr19 scaffold_4, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (24%)
          Length = 592

 Score = 61.9 bits (31), Expect = 2e-08
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 2074 gatcctgagtacttcagaaggcaacaactgaccgaaaaatctgatatttattcatttgg 2132
            ||||||||||| || |||||||| ||||| || || ||||||||| |||||||||||||
Sbjct: 370  gatcctgagtattttagaaggcagcaacttacagagaaatctgatgtttattcatttgg 428


>gnl|LJGI|BP042662 similar to UniRef100_Q94KF2 Cluster: Pto-like kinase SG5-3e; n=1;
            Phaseolus vulgaris|Rep: Pto-like kinase SG5-3e -
            Phaseolus vulgaris (Kidney bean) (French bean), partial
            (39%)
          Length = 484

 Score = 60.0 bits (30), Expect = 7e-08
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 2074 gatcctgagtacttcagaaggcaacaactgaccgaaaaatctgatatttattcatttggg 2133
            ||||||||||| |||||   |||||| ||||| |||||||||||| | ||||||||||||
Sbjct: 434  gatcctgagtatttcaggtcgcaacagctgacggaaaaatctgatgtatattcatttggg 375

              
Query: 2134 gt 2135
            ||
Sbjct: 374  gt 373