Miyakogusa Predicted Gene

Lj1g3v4931570.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4931570.1 Non Chatacterized Hit- tr|I1JRC5|I1JRC5_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.18572
PE,85.95,0,Pkinase,Protein kinase, catalytic domain; seg,NULL; no
description,NULL; PROTEIN_KINASE_DOM,Protein ,CUFF.33643.1
         (1089 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO009729                                                      52   7e-06

>gnl|LJGI|GO009729 
          Length = 300

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 298 caggttttgattgcagcaagttcgaaggagaaggcaca 335
           |||||||||||||||||||||| ||||  |||||||||
Sbjct: 72  caggttttgattgcagcaagtttgaagcggaaggcaca 109