Miyakogusa Predicted Gene
- Lj1g3v4899040.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v4899040.1 Non Chatacterized Hit- tr|I1NB50|I1NB50_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,86.21,0,FAMILY NOT
NAMED,NULL; Glyco_transf_34,Galactosyl transferase;
seg,NULL,CUFF.33545.1
(1358 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC63782 homologue to UniRef100_Q5TIN3 Cluster: Alpha-1,... 281 6e-75
gnl|LJGI|TC57156 homologue to UniRef100_A7PDI4 Cluster: Chromoso... 76 6e-13
gnl|LJGI|BP078437 homologue to UniRef100_A7PDI4 Cluster: Chromos... 66 6e-10
gnl|LJGI|TC65943 homologue to UniRef100_A7PDI4 Cluster: Chromoso... 66 6e-10
>gnl|LJGI|TC63782 homologue to UniRef100_Q5TIN3 Cluster: Alpha-1,6-xylosyltransferase;
n=1; Gossypium raimondii|Rep:
Alpha-1,6-xylosyltransferase - Gossypium raimondii (New
World cotton), partial (35%)
Length = 723
Score = 281 bits (142), Expect = 6e-75
Identities = 340/406 (83%)
Strand = Plus / Plus
Query: 911 tttttgaagctgatgatcaatcagcgatggtttatttgctggcgaaaaagagggacttgt 970
|||| ||||||||||||||||| || |||||||||||| |||| | | |||||| |
Sbjct: 15 ttttcgaagctgatgatcaatctgctatggtttatttgttggccacagggagggagcaat 74
Query: 971 ggggtgataaggtttatcttgagaatggttattacttgcatggttactggggtattctgg 1030
|||| | ||||| || ||||||||| |||||| ||||| ||||||||||| |||||||
Sbjct: 75 gggggaagaaggtgtaccttgagaatcattattatttgcacggttactggggcattctgg 134
Query: 1031 ttgataagtatgaggagatgattgagaattaccaccctggttttggggatcataggtggc 1090
||||| |||||| ||||||||||||||||||||||||||||| || |||||| ||||||
Sbjct: 135 ttgatcggtatgaagagatgattgagaattaccaccctggtttcggtgatcatcggtggc 194
Query: 1091 cgttggtcactcattttgtgggttgtaagccttgtgggaagtttggggattaccctgttg 1150
|| |||| ||||| |||||||| || ||||| ||||||||||||||||||||||||||||
Sbjct: 195 cgctggtgactcactttgtggggtgcaagccatgtgggaagtttggggattaccctgttg 254
Query: 1151 agagatgcttgaagcagatggatagggctttcaattttggagataaccagatactgcaga 1210
|||| |||||||| ||||||||||| || | ||||||||| ||||||||||| ||||||
Sbjct: 255 agaggtgcttgaaacagatggatagagcatacaattttggtgataaccagatcttgcaga 314
Query: 1211 tttatgggttcactcacaagtctttgggtagtaggagggttaagagaatacggaatgaga 1270
| ||||| ||||| ||||| || | | ||| | ||||| |||||| | ||||||||
Sbjct: 315 tgtatggattcacacacaaatcacttgcgagtcgcagggtgaagagagtgaggaatgagt 374
Query: 1271 gtagcaatcctcttgaggtcaaagatgaacttggcttgcttcatcc 1316
||| ||||| ||||| || || ||||| ||||| |||||||||||
Sbjct: 375 ctagtaatccacttgatgtgaaggatgagcttgggttgcttcatcc 420
>gnl|LJGI|TC57156 homologue to UniRef100_A7PDI4 Cluster: Chromosome chr17 scaffold_12,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr17 scaffold_12, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (88%)
Length = 1648
Score = 75.8 bits (38), Expect = 6e-13
Identities = 68/78 (87%)
Strand = Plus / Plus
Query: 778 actgggagctttctgttgaggaactgccaatggtctttggatattcttgatgcctgggcg 837
|||||||||||||| || ||||| ||||| |||||||||||| | |||||||| |||||
Sbjct: 934 actgggagctttcttttcaggaattgccagtggtctttggatttgcttgatgcttgggct 993
Query: 838 ccaatggggccaaaaggg 855
|||||||| || ||||||
Sbjct: 994 ccaatgggtcctaaaggg 1011
Score = 73.8 bits (37), Expect = 3e-12
Identities = 76/89 (85%)
Strand = Plus / Plus
Query: 448 ccgaaaccgtgtgagaatcctgttggggatcattacttgttgaagtctattaagaacaag 507
||||| || ||||| ||||| |||| || ||||||||||||||||| ||||||||||||
Sbjct: 604 ccgaagccctgtgataatccaattggtgaccattacttgttgaagtccattaagaacaag 663
Query: 508 attgattattgtcgcttgcatggtattga 536
|||||||| ||| | || ||||| |||||
Sbjct: 664 attgattactgtagattacatgggattga 692
Score = 52.0 bits (26), Expect = 9e-06
Identities = 59/70 (84%)
Strand = Plus / Plus
Query: 1084 aggtggccgttggtcactcattttgtgggttgtaagccttgtgggaagtttggggattac 1143
||||||||||| || || ||||||||||| || ||||| ||||||| | || ||||||
Sbjct: 1240 aggtggccgtttgtgacgcattttgtggggtgcaagccctgtgggagctacggagattac 1299
Query: 1144 cctgttgaga 1153
||||||||||
Sbjct: 1300 cctgttgaga 1309
>gnl|LJGI|BP078437 homologue to UniRef100_A7PDI4 Cluster: Chromosome chr17 scaffold_12,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr17 scaffold_12, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (18%)
Length = 553
Score = 65.9 bits (33), Expect = 6e-10
Identities = 89/105 (84%), Gaps = 2/105 (1%)
Strand = Plus / Minus
Query: 1084 aggtggccgttggtcactcattttgtgggttgtaagccttgtgggaagtttggggattac 1143
||||||||||| || || |||||||| || || ||||||||||||| | |||||||||
Sbjct: 531 aggtggccgttcgtgacgcattttgtcgggtgcaagccttgtgggagctacggggattac 472
Query: 1144 cctgttgagagatgcttgaagcag-atggatagggctttcaattt 1187
||||| ||||| |||||| || || ||||| ||||||||||||||
Sbjct: 471 cctgtggagaggtgcttg-agtagcatggagagggctttcaattt 428
>gnl|LJGI|TC65943 homologue to UniRef100_A7PDI4 Cluster: Chromosome chr17 scaffold_12,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr17 scaffold_12, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (36%)
Length = 899
Score = 65.9 bits (33), Expect = 6e-10
Identities = 89/105 (84%), Gaps = 2/105 (1%)
Strand = Plus / Plus
Query: 1084 aggtggccgttggtcactcattttgtgggttgtaagccttgtgggaagtttggggattac 1143
||||||||||| || || |||||||| || || ||||||||||||| | |||||||||
Sbjct: 274 aggtggccgttcgtgacgcattttgtcgggtgcaagccttgtgggagctacggggattac 333
Query: 1144 cctgttgagagatgcttgaagcag-atggatagggctttcaattt 1187
||||| ||||| |||||| || || ||||| ||||||||||||||
Sbjct: 334 cctgtggagaggtgcttg-agtagcatggagagggctttcaattt 377