Miyakogusa Predicted Gene

Lj1g3v4819990.2
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4819990.2 tr|G7KVH4|G7KVH4_MEDTR Glucose-1-phosphate
adenylyltransferase OS=Medicago truncatula
GN=MTR_7g11102,80.77,0,glgC: glucose-1-phosphate
adenylyltransferase,Glucose-1-phosphate adenylyltransferase; no
descriptio,CUFF.33352.2
         (1614 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61551 similar to UniRef100_Q9AT07 Cluster: Glucose-1-...    78   2e-13

>gnl|LJGI|TC61551 similar to UniRef100_Q9AT07 Cluster: Glucose-1-phosphate
            adenylyltransferase; n=1; Cicer arietinum|Rep:
            Glucose-1-phosphate adenylyltransferase - Cicer arietinum
            (Chickpea) (Garbanzo), partial (87%)
          Length = 2439

 Score = 77.8 bits (39), Expect = 2e-13
 Identities = 147/183 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1284 tgttgaacattccattgttggaatccgctcaaaaattgattctggagtgcagctaaagga 1343
            |||| ||||||| ||||||||||| ||||||    | || ||||| ||| ||||  ||||
Sbjct: 1432 tgttcaacattctattgttggaatacgctcacgtttagagtctggtgtggagcttcagga 1491

                                                                        
Query: 1344 tacattgatgatgggtgctgactattaccaaacagaggctgaaatagcagctcttttagc 1403
            |||  |||||||||||||||| || || ||||| ||| | ||||| ||| ||||  | ||
Sbjct: 1492 taccatgatgatgggtgctgattactatcaaactgagacggaaattgcatctctggtggc 1551

                                                                        
Query: 1404 agctggaaatgttccaataggtattggtaaaaataccaaaatcatgaattgtataattga 1463
            ||  ||||| |||||||| ||| ||||  ||||||||||||||| |||||| ||||| ||
Sbjct: 1552 agaaggaaaggttccaattggtgttggagaaaataccaaaatcaggaattgcataatcga 1611

               
Query: 1464 caa 1466
            |||
Sbjct: 1612 caa 1614



 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1060 aatgtccaggcatgtcttttcagtggttattgggaggatattgggactataaaatctttc 1119
            ||||||||||||| | | |||| ||  || ||||| |||||||| |||||||| || |||
Sbjct: 1208 aatgtccaggcatatttgttcaatgactactgggaagatattggaactataaagtccttc 1267

                       
Query: 1120 tttgatgcaaa 1130
            |||||||||||
Sbjct: 1268 tttgatgcaaa 1278