Miyakogusa Predicted Gene
- Lj1g3v4809890.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v4809890.1 tr|B9GRW7|B9GRW7_POPTR Predicted protein
OS=Populus trichocarpa GN=MYB121 PE=4
SV=1,33.72,0.18,Homeodomain-like,Homeodomain-like; no
description,Homeodomain-like; seg,NULL;
Myb_DNA-binding,SANT/M,CUFF.33343.1
(1185 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB tra... 361 7e-99
gnl|LJGI|FS328706 similar to UniRef100_A7Q0Y1 Cluster: Chromosom... 170 1e-41
gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromos... 62 8e-09
gnl|LJGI|AV776018 similar to UniRef100_Q0PJD4 Cluster: MYB trans... 62 8e-09
gnl|LJGI|TC81472 homologue to UniRef100_Q2LME4 Cluster: MYB20; n... 62 8e-09
gnl|LJGI|AV766688 similar to UniRef100_Q0PJC1 Cluster: MYB trans... 60 3e-08
gnl|LJGI|GO012149 similar to UniRef100_A7R2L2 Cluster: Chromosom... 58 1e-07
gnl|LJGI|TC76156 homologue to UniRef100_Q43525 Cluster: Transcri... 54 2e-06
gnl|LJGI|TC69494 UniRef100_Q84PP4 Cluster: Transcription factor ... 54 2e-06
gnl|LJGI|TC58575 similar to UniRef100_A7QY25 Cluster: Chromosome... 54 2e-06
gnl|LJGI|TC75727 similar to UniRef100_Q0PJC1 Cluster: MYB transc... 52 8e-06
gnl|LJGI|TC69448 similar to UniRef100_Q0PJC1 Cluster: MYB transc... 52 8e-06
>gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB transcription factor
MYB160; n=1; Glycine max|Rep: MYB transcription factor
MYB160 - Glycine max (Soybean), partial (60%)
Length = 351
Score = 361 bits (182), Expect = 7e-99
Identities = 308/350 (88%)
Strand = Plus / Plus
Query: 29 agaagcttcggaaaggactctggtctccagatgaagatgaaaagcttttgaattacatca 88
||||||| || ||||| |||||||||||||| |||||||||||||| |||||| ||||||
Sbjct: 1 agaagctacgcaaaggtctctggtctccagaggaagatgaaaagctcttgaatcacatca 60
Query: 89 cacaacatggccatggttgttggagttcagttccaaagctagctggtttgcagaggtgtg 148
| ||||||||||||| || ||||| || || ||||| ||||||||||||||||||||||
Sbjct: 61 ccaaacatggccatggatgctggagctccgtcccaaaactagctggtttgcagaggtgtg 120
Query: 149 ggaagagttgcagattgaggtggataaattaccttagaccggatttgaagaggggagcat 208
||||||| ||||| |||||||||||||||||||| || || ||||||||||| |||||||
Sbjct: 121 ggaagagctgcaggttgaggtggataaattacctgaggcctgatttgaagagaggagcat 180
Query: 209 tctcacagcaggaagaggattcaataattgaacttcatgcagtacttggcaacaggtggt 268
||||||| ||||||||| ||| || |||||||| ||||| || |||||||||||||||
Sbjct: 181 tctcacaacaggaagagaatttgatcattgaactccatgccgtccttggcaacaggtggg 240
Query: 269 ctcagattgcagctcagttaccaggaagaactgacaatgagataaagaatttatggaatt 328
||||||||||||| ||||||||||||||||||||||||||||| || ||| | |||||||
Sbjct: 241 ctcagattgcagcacagttaccaggaagaactgacaatgagattaaaaatctgtggaatt 300
Query: 329 ccagtctgaagaagaaactgaggcaaagaggcattgacccaaacacccac 378
| | || ||||||| || |||||||||||||||||||||| |||||||
Sbjct: 301 catgccttaagaagaggctcaggcaaagaggcattgacccaagcacccac 350
>gnl|LJGI|FS328706 similar to UniRef100_A7Q0Y1 Cluster: Chromosome chr7 scaffold_42,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr7 scaffold_42, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (35%)
Length = 765
Score = 170 bits (86), Expect = 1e-41
Identities = 287/354 (81%)
Strand = Plus / Plus
Query: 1 atgggaagacactcttgctgttacaagcagaagcttcggaaaggactctggtctccagat 60
|||||||||||||| ||||| ||||||||||||||| |||| || || ||||| |||||
Sbjct: 150 atgggaagacactcatgctgctacaagcagaagcttaggaagggtctgtggtcaccagag 209
Query: 61 gaagatgaaaagcttttgaattacatcacacaacatggccatggttgttggagttcagtt 120
|||||||| || ||| ||| | || || | |||||||||| ||||||||||| ||
Sbjct: 210 gaagatgagaaacttctgaggcatattacgaagtatggccatggatgttggagttctgtg 269
Query: 121 ccaaagctagctggtttgcagaggtgtgggaagagttgcagattgaggtggataaattac 180
|| |||| ||| ||||||||||||||||| ||||| ||||| | |||||||| ||||||
Sbjct: 270 cctaagcaagcaggtttgcagaggtgtggtaagagctgcaggcttaggtggatcaattac 329
Query: 181 cttagaccggatttgaagaggggagcattctcacagcaggaagaggattcaataattgaa 240
| || || ||||| || || ||| |||||||||| | ||||| || |||||||||
Sbjct: 330 ttaaggcctgatttaaaaagaggaacattctcacaagaagaagaaaatcttataattgaa 389
Query: 241 cttcatgcagtacttggcaacaggtggtctcagattgcagctcagttaccaggaagaact 300
|||||||||||||| || ||||| |||||||| ||||| || || || || ||||| ||
Sbjct: 390 cttcatgcagtactagggaacagatggtctcaaattgcggcgcaattgccgggaaggacc 449
Query: 301 gacaatgagataaagaatttatggaattccagtctgaagaagaaactgaggcaa 354
|||||||| ||||||||| | ||||| || | ||||||||||| |||||||||
Sbjct: 450 gacaatgaaataaagaatctttggaactcttgcctgaagaagaagctgaggcaa 503
>gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromosome chr17
scaffold_12, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr17 scaffold_12, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (19%)
Length = 487
Score = 61.9 bits (31), Expect = 8e-09
Identities = 82/99 (82%)
Strand = Plus / Plus
Query: 102 tggttgttggagttcagttccaaagctagctggtttgcagaggtgtgggaagagttgcag 161
|||||| |||||||| ||||| || | |||||| |||| || ||||| |||||||||||
Sbjct: 380 tggttgctggagttctgttcccaaacaagctggactgcaaagatgtggaaagagttgcag 439
Query: 162 attgaggtggataaattaccttagaccggatttgaagag 200
||||| |||||||| ||| | || || |||||||||||
Sbjct: 440 gttgagatggataaactacttgaggcctgatttgaagag 478
>gnl|LJGI|AV776018 similar to UniRef100_Q0PJD4 Cluster: MYB transcription factor
MYB64; n=1; Glycine max|Rep: MYB transcription factor
MYB64 - Glycine max (Soybean), partial (52%)
Length = 476
Score = 61.9 bits (31), Expect = 8e-09
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 298 actgacaatgagataaagaatttatggaattccagtctgaagaagaaactgaggcaaaga 357
||||||||||| ||||||||| | |||||||| | ||||||||||||| |||||||||
Sbjct: 103 actgacaatgaaataaagaatctgtggaattcttgcttgaagaagaaactcaggcaaaga 162
Query: 358 ggcattgaccc 368
|| || |||||
Sbjct: 163 ggtatagaccc 173
>gnl|LJGI|TC81472 homologue to UniRef100_Q2LME4 Cluster: MYB20; n=1; Malus x
domestica|Rep: MYB20 - Malus domestica (Apple) (Malus
sylvestris), partial (42%)
Length = 1348
Score = 61.9 bits (31), Expect = 8e-09
Identities = 67/79 (84%)
Strand = Plus / Plus
Query: 253 cttggcaacaggtggtctcagattgcagctcagttaccaggaagaactgacaatgagata 312
||||| ||||| |||||||| ||||| || | ||||| || |||||||||||||||||
Sbjct: 308 cttggaaacagatggtctcaaattgcggcacgcttacctgggagaactgacaatgagatt 367
Query: 313 aagaatttatggaattcca 331
||||| || ||||||||||
Sbjct: 368 aagaacttttggaattcca 386
>gnl|LJGI|AV766688 similar to UniRef100_Q0PJC1 Cluster: MYB transcription factor
MYB122; n=1; Glycine max|Rep: MYB transcription factor
MYB122 - Glycine max (Soybean), partial (77%)
Length = 595
Score = 60.0 bits (30), Expect = 3e-08
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 142 aggtgtgggaagagttgcagattgaggtggataaatta 179
||||||||||||||||| |||||||||||| |||||||
Sbjct: 218 aggtgtgggaagagttgtagattgaggtggctaaatta 255
>gnl|LJGI|GO012149 similar to UniRef100_A7R2L2 Cluster: Chromosome undetermined
scaffold_434, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_434,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (47%)
Length = 707
Score = 58.0 bits (29), Expect = 1e-07
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 253 cttggcaacaggtggtctcagattgcagctcagttaccaggaagaactgacaatgagata 312
|||||||||| ||||||| |||||| ||| ||||||||||||||| |||||||| ||
Sbjct: 391 cttggcaacaagtggtctgcaattgcatctcggttaccaggaagaacagacaatgaaatc 450
Query: 313 aagaa 317
|||||
Sbjct: 451 aagaa 455
>gnl|LJGI|TC76156 homologue to UniRef100_Q43525 Cluster: Transcription factor; n=1;
Solanum lycopersicum|Rep: Transcription factor - Solanum
lycopersicum (Tomato) (Lycopersicon esculentum), partial
(61%)
Length = 1383
Score = 54.0 bits (27), Expect = 2e-06
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 289 ccaggaagaactgacaatgagataaagaatt 319
||||||||||| |||||||||||||||||||
Sbjct: 562 ccaggaagaacagacaatgagataaagaatt 592
>gnl|LJGI|TC69494 UniRef100_Q84PP4 Cluster: Transcription factor MYB102; n=1; Lotus
japonicus|Rep: Transcription factor MYB102 - Lotus
japonicus, complete
Length = 1245
Score = 54.0 bits (27), Expect = 2e-06
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 292 ggaagaactgacaatgagataaagaatttatggaa 326
|||||||||||||||||||| |||||||| |||||
Sbjct: 323 ggaagaactgacaatgagatcaagaatttttggaa 357
>gnl|LJGI|TC58575 similar to UniRef100_A7QY25 Cluster: Chromosome undetermined
scaffold_237, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_237,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (63%)
Length = 799
Score = 54.0 bits (27), Expect = 2e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 142 aggtgtgggaagagttgcagattgaggtggataaattaccttagacc 188
|||||||||||||||||||||||||| ||| | || ||||| |||||
Sbjct: 177 aggtgtgggaagagttgcagattgagatggttgaactacctgagacc 223
>gnl|LJGI|TC75727 similar to UniRef100_Q0PJC1 Cluster: MYB transcription factor
MYB122; n=1; Glycine max|Rep: MYB transcription factor
MYB122 - Glycine max (Soybean), partial (72%)
Length = 1301
Score = 52.0 bits (26), Expect = 8e-06
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 142 aggtgtgggaagagttgcagattgaggtgg 171
||||||||||| ||||||||||||||||||
Sbjct: 368 aggtgtgggaaaagttgcagattgaggtgg 397
>gnl|LJGI|TC69448 similar to UniRef100_Q0PJC1 Cluster: MYB transcription factor
MYB122; n=1; Glycine max|Rep: MYB transcription factor
MYB122 - Glycine max (Soybean), partial (73%)
Length = 712
Score = 52.0 bits (26), Expect = 8e-06
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 142 aggtgtgggaagagttgcagattgaggtgg 171
||||||||||| ||||||||||||||||||
Sbjct: 233 aggtgtgggaaaagttgcagattgaggtgg 262