Miyakogusa Predicted Gene
- Lj1g3v4764520.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v4764520.2 Non Chatacterized Hit- tr|I1KBY1|I1KBY1_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,57.89,2e-18,DNA-binding pseudobarrel domain,DNA-binding
pseudobarrel domain; CAD & PB1 domains,NULL; no descript,CUFF.33196.2
(1974 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC72914 similar to UniRef100_Q56YP4 Cluster: ARF1-bindi... 54 3e-06
>gnl|LJGI|TC72914 similar to UniRef100_Q56YP4 Cluster: ARF1-binding protein; n=1;
Arabidopsis thaliana|Rep: ARF1-binding protein -
Arabidopsis thaliana (Mouse-ear cress), partial (11%)
Length = 586
Score = 54.0 bits (27), Expect = 3e-06
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 296 acacagatgaggtttttgctcaagtgacattacttccag 334
||||||||||||| |||||||| ||||| ||||||||||
Sbjct: 548 acacagatgaggtgtttgctcaggtgaccttacttccag 586