Miyakogusa Predicted Gene

Lj1g3v4764520.2
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4764520.2 Non Chatacterized Hit- tr|I1KBY1|I1KBY1_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,57.89,2e-18,DNA-binding pseudobarrel domain,DNA-binding
pseudobarrel domain; CAD & PB1 domains,NULL; no descript,CUFF.33196.2
         (1974 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72914 similar to UniRef100_Q56YP4 Cluster: ARF1-bindi...    54   3e-06

>gnl|LJGI|TC72914 similar to UniRef100_Q56YP4 Cluster: ARF1-binding protein; n=1;
           Arabidopsis thaliana|Rep: ARF1-binding protein -
           Arabidopsis thaliana (Mouse-ear cress), partial (11%)
          Length = 586

 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 296 acacagatgaggtttttgctcaagtgacattacttccag 334
           ||||||||||||| |||||||| ||||| ||||||||||
Sbjct: 548 acacagatgaggtgtttgctcaggtgaccttacttccag 586