Miyakogusa Predicted Gene

Lj1g3v4753100.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4753100.1 Non Chatacterized Hit- tr|A9NZD4|A9NZD4_PICSI
Putative uncharacterized protein OS=Picea sitchensis
P,79.25,0.000000000000001,FAS1,FAS1 domain; FAS1 domain,FAS1 domain;
SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
seg,NULL,NODE_28953_length_752_cov_381.132965.path1.1
         (657 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC76210 similar to UniRef100_A9XTL9 Cluster: Fasciclin-...   726   0.0  
gnl|LJGI|TC64796 homologue to UniRef100_A7Q060 Cluster: Chromoso...   287   4e-77
gnl|LJGI|TC62931 similar to UniRef100_A9XTM0 Cluster: Fasciclin-...   210   8e-54
gnl|LJGI|TC74952 similar to UniRef100_A9XTM1 Cluster: Fasciclin-...   178   3e-44
gnl|LJGI|TC58313 similar to UniRef100_A9XTM0 Cluster: Fasciclin-...   151   6e-36

>gnl|LJGI|TC76210 similar to UniRef100_A9XTL9 Cluster: Fasciclin-like arabinogalactan
           protein 14; n=1; Gossypium hirsutum|Rep: Fasciclin-like
           arabinogalactan protein 14 - Gossypium hirsutum (Upland
           cotton) (Gossypium mexicanum), partial (39%)
          Length = 970

 Score =  726 bits (366), Expect = 0.0
 Identities = 366/366 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtcccacattctccccgccagaatctccgaccataacttccccgccaccgaccgccgc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 605 atgtcccacattctccccgccagaatctccgaccataacttccccgccaccgaccgccgc 664

                                                                       
Query: 61  caccgaacgctatcccccgaccaccacctcaatctcgccaccaaccccacctccggcaag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 665 caccgaacgctatcccccgaccaccacctcaatctcgccaccaaccccacctccggcaag 724

                                                                       
Query: 121 aaaacagtcgactccgccgagatcctccgcccaaacgatgttctccgccctgacggcgtc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 725 aaaacagtcgactccgccgagatcctccgcccaaacgatgttctccgccctgacggcgtc 784

                                                                       
Query: 181 atccacgggatcgacagcctcatcgtgccacgttccgtgcaggaggatttcaaccggagg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 785 atccacgggatcgacagcctcatcgtgccacgttccgtgcaggaggatttcaaccggagg 844

                                                                       
Query: 241 agaagcctccgcgcgatctctgcggtgctcccggagggagcgccgcaggtcgatccccgg 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 845 agaagcctccgcgcgatctctgcggtgctcccggagggagcgccgcaggtcgatccccgg 904

                                                                       
Query: 301 accaaccgcttgaagaaaccagcccccgtcccagccggcgcgcctccggtactcccgatc 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 905 accaaccgcttgaagaaaccagcccccgtcccagccggcgcgcctccggtactcccgatc 964

                 
Query: 361 tacgac 366
           ||||||
Sbjct: 965 tacgac 970


>gnl|LJGI|TC64796 homologue to UniRef100_A7Q060 Cluster: Chromosome chr8 scaffold_41,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr8 scaffold_41, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (32%)
          Length = 862

 Score =  287 bits (145), Expect = 4e-77
 Identities = 145/145 (100%)
 Strand = Plus / Plus

                                                                       
Query: 513 ggtgaatctgacctccctcgccaccgagatggggaggttggtttctgaaggctacgttct 572
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtgaatctgacctccctcgccaccgagatggggaggttggtttctgaaggctacgttct 60

                                                                       
Query: 573 caccgttttggctcccaatgacgaggcgatggcgaagctgacgacggaccagctgagcga 632
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  caccgttttggctcccaatgacgaggcgatggcgaagctgacgacggaccagctgagcga 120

                                    
Query: 633 accgggtgcgccggagcagatcatc 657
           |||||||||||||||||||||||||
Sbjct: 121 accgggtgcgccggagcagatcatc 145


>gnl|LJGI|TC62931 similar to UniRef100_A9XTM0 Cluster: Fasciclin-like arabinogalactan
            protein 15; n=1; Gossypium hirsutum|Rep: Fasciclin-like
            arabinogalactan protein 15 - Gossypium hirsutum (Upland
            cotton) (Gossypium mexicanum), partial (63%)
          Length = 1281

 Score =  210 bits (106), Expect = 8e-54
 Identities = 253/302 (83%)
 Strand = Plus / Plus

                                                                        
Query: 355  ccgatctacgacgcgcttgctccaggaccgtcactcgctccggcgccggcgccaggacct 414
            ||||||||||||||  | ||||| || || || |||||||||||||| || ||||| || 
Sbjct: 867  ccgatctacgacgcaatggctccgggtccttccctcgctccggcgccagcaccaggcccc 926

                                                                        
Query: 415  ggaggaccacgccaccacttcaacggcgagaaacaggtgaaggatttcatccaaacgctc 474
            || || || | |||||||||||||||||||   ||||||||||| |||||||| ||||| 
Sbjct: 927  ggcgggccccaccaccacttcaacggcgaggcccaggtgaaggacttcatccacacgctt 986

                                                                        
Query: 475  gtgcattacggcggttacaacgaaatggcggatattctggtgaatctgacctccctcgcc 534
             | || |||||||| |||||||| |||||||| ||||| || || || |||||| | |||
Sbjct: 987  ctccactacggcgggtacaacgagatggcggacattctcgtcaacctcacctccttagcc 1046

                                                                        
Query: 535  accgagatggggaggttggtttctgaaggctacgttctcaccgttttggctcccaatgac 594
            ||||| |||||  |||||||||| ||||||||||||||||||||  | |||||||| || 
Sbjct: 1047 accgaaatgggtcggttggtttccgaaggctacgttctcaccgtcctcgctcccaacgat 1106

                                                                        
Query: 595  gaggcgatggcgaagctgacgacggaccagctgagcgaaccgggtgcgccggagcagatc 654
            || || |||||||| ||||||||||| ||| |||| ||||| ||||||||||||||||||
Sbjct: 1107 gaagccatggcgaaactgacgacggagcagttgagtgaacccggtgcgccggagcagatc 1166

              
Query: 655  at 656
            ||
Sbjct: 1167 at 1168


>gnl|LJGI|TC74952 similar to UniRef100_A9XTM1 Cluster: Fasciclin-like arabinogalactan
           protein 16; n=1; Gossypium hirsutum|Rep: Fasciclin-like
           arabinogalactan protein 16 - Gossypium hirsutum (Upland
           cotton) (Gossypium mexicanum), partial (26%)
          Length = 518

 Score =  178 bits (90), Expect = 3e-44
 Identities = 246/298 (82%)
 Strand = Plus / Plus

                                                                       
Query: 356 cgatctacgacgcgcttgctccaggaccgtcactcgctccggcgccggcgccaggacctg 415
           ||||||| || || ||||| || ||||| || || ||||||||||| || || |||||||
Sbjct: 113 cgatctatgaagctcttgccccgggaccctctcttgctccggcgccagctccgggacctg 172

                                                                       
Query: 416 gaggaccacgccaccacttcaacggcgagaaacaggtgaaggatttcatccaaacgctcg 475
           | || || | |||||||||||||||||||   ||||||||||||||||||||||| ||  
Sbjct: 173 gtggcccccaccaccacttcaacggcgaggcgcaggtgaaggatttcatccaaaccctgc 232

                                                                       
Query: 476 tgcattacggcggttacaacgaaatggcggatattctggtgaatctgacctccctcgcca 535
           | || |||||||| |||||||| ||||| || ||||||||||| ||||  ||  | || |
Sbjct: 233 ttcactacggcgggtacaacgagatggctgacattctggtgaacctgatgtcgttggcta 292

                                                                       
Query: 536 ccgagatggggaggttggtttctgaaggctacgttctcaccgttttggctcccaatgacg 595
           | || |||||  | ||||| || || || || |||||||| || || ||||| || || |
Sbjct: 293 ctgaaatgggtcgtttggtgtcggagggttatgttctcactgtattagctccgaacgatg 352

                                                                     
Query: 596 aggcgatggcgaagctgacgacggaccagctgagcgaaccgggtgcgccggagcagat 653
           |||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 353 aggccatggcgaagctgacgacggagcagctgagcgaaccgggtgcgccggagcagat 410


>gnl|LJGI|TC58313 similar to UniRef100_A9XTM0 Cluster: Fasciclin-like arabinogalactan
           protein 15; n=1; Gossypium hirsutum|Rep: Fasciclin-like
           arabinogalactan protein 15 - Gossypium hirsutum (Upland
           cotton) (Gossypium mexicanum), partial (37%)
          Length = 1076

 Score =  151 bits (76), Expect = 6e-36
 Identities = 151/176 (85%)
 Strand = Plus / Plus

                                                                       
Query: 481 tacggcggttacaacgaaatggcggatattctggtgaatctgacctccctcgccaccgag 540
           |||||||| |||||||| |||||||| ||||| || || || |||||| | |||||||| 
Sbjct: 5   tacggcgggtacaacgagatggcggacattctcgtcaacctcacctccttagccaccgaa 64

                                                                       
Query: 541 atggggaggttggtttctgaaggctacgttctcaccgttttggctcccaatgacgaggcg 600
           |||||  |||||||||| ||||||||||||||||||||  | |||||||| || || || 
Sbjct: 65  atgggtcggttggtttccgaaggctacgttctcaccgtcctcgctcccaacgatgaagcc 124

                                                                   
Query: 601 atggcgaagctgacgacggaccagctgagcgaaccgggtgcgccggagcagatcat 656
           |||||||| ||||||||||| ||| |||| ||||| ||||||||||||||||||||
Sbjct: 125 atggcgaaactgacgacggagcagttgagtgaacccggtgcgccggagcagatcat 180