Miyakogusa Predicted Gene
- Lj1g3v4753100.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v4753100.1 Non Chatacterized Hit- tr|A9NZD4|A9NZD4_PICSI
Putative uncharacterized protein OS=Picea sitchensis
P,79.25,0.000000000000001,FAS1,FAS1 domain; FAS1 domain,FAS1 domain;
SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
seg,NULL,NODE_28953_length_752_cov_381.132965.path1.1
(657 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC76210 similar to UniRef100_A9XTL9 Cluster: Fasciclin-... 726 0.0
gnl|LJGI|TC64796 homologue to UniRef100_A7Q060 Cluster: Chromoso... 287 4e-77
gnl|LJGI|TC62931 similar to UniRef100_A9XTM0 Cluster: Fasciclin-... 210 8e-54
gnl|LJGI|TC74952 similar to UniRef100_A9XTM1 Cluster: Fasciclin-... 178 3e-44
gnl|LJGI|TC58313 similar to UniRef100_A9XTM0 Cluster: Fasciclin-... 151 6e-36
>gnl|LJGI|TC76210 similar to UniRef100_A9XTL9 Cluster: Fasciclin-like arabinogalactan
protein 14; n=1; Gossypium hirsutum|Rep: Fasciclin-like
arabinogalactan protein 14 - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), partial (39%)
Length = 970
Score = 726 bits (366), Expect = 0.0
Identities = 366/366 (100%)
Strand = Plus / Plus
Query: 1 atgtcccacattctccccgccagaatctccgaccataacttccccgccaccgaccgccgc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 605 atgtcccacattctccccgccagaatctccgaccataacttccccgccaccgaccgccgc 664
Query: 61 caccgaacgctatcccccgaccaccacctcaatctcgccaccaaccccacctccggcaag 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 665 caccgaacgctatcccccgaccaccacctcaatctcgccaccaaccccacctccggcaag 724
Query: 121 aaaacagtcgactccgccgagatcctccgcccaaacgatgttctccgccctgacggcgtc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 725 aaaacagtcgactccgccgagatcctccgcccaaacgatgttctccgccctgacggcgtc 784
Query: 181 atccacgggatcgacagcctcatcgtgccacgttccgtgcaggaggatttcaaccggagg 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 785 atccacgggatcgacagcctcatcgtgccacgttccgtgcaggaggatttcaaccggagg 844
Query: 241 agaagcctccgcgcgatctctgcggtgctcccggagggagcgccgcaggtcgatccccgg 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 845 agaagcctccgcgcgatctctgcggtgctcccggagggagcgccgcaggtcgatccccgg 904
Query: 301 accaaccgcttgaagaaaccagcccccgtcccagccggcgcgcctccggtactcccgatc 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 905 accaaccgcttgaagaaaccagcccccgtcccagccggcgcgcctccggtactcccgatc 964
Query: 361 tacgac 366
||||||
Sbjct: 965 tacgac 970
>gnl|LJGI|TC64796 homologue to UniRef100_A7Q060 Cluster: Chromosome chr8 scaffold_41,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr8 scaffold_41, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (32%)
Length = 862
Score = 287 bits (145), Expect = 4e-77
Identities = 145/145 (100%)
Strand = Plus / Plus
Query: 513 ggtgaatctgacctccctcgccaccgagatggggaggttggtttctgaaggctacgttct 572
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 ggtgaatctgacctccctcgccaccgagatggggaggttggtttctgaaggctacgttct 60
Query: 573 caccgttttggctcccaatgacgaggcgatggcgaagctgacgacggaccagctgagcga 632
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 caccgttttggctcccaatgacgaggcgatggcgaagctgacgacggaccagctgagcga 120
Query: 633 accgggtgcgccggagcagatcatc 657
|||||||||||||||||||||||||
Sbjct: 121 accgggtgcgccggagcagatcatc 145
>gnl|LJGI|TC62931 similar to UniRef100_A9XTM0 Cluster: Fasciclin-like arabinogalactan
protein 15; n=1; Gossypium hirsutum|Rep: Fasciclin-like
arabinogalactan protein 15 - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), partial (63%)
Length = 1281
Score = 210 bits (106), Expect = 8e-54
Identities = 253/302 (83%)
Strand = Plus / Plus
Query: 355 ccgatctacgacgcgcttgctccaggaccgtcactcgctccggcgccggcgccaggacct 414
|||||||||||||| | ||||| || || || |||||||||||||| || ||||| ||
Sbjct: 867 ccgatctacgacgcaatggctccgggtccttccctcgctccggcgccagcaccaggcccc 926
Query: 415 ggaggaccacgccaccacttcaacggcgagaaacaggtgaaggatttcatccaaacgctc 474
|| || || | ||||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 927 ggcgggccccaccaccacttcaacggcgaggcccaggtgaaggacttcatccacacgctt 986
Query: 475 gtgcattacggcggttacaacgaaatggcggatattctggtgaatctgacctccctcgcc 534
| || |||||||| |||||||| |||||||| ||||| || || || |||||| | |||
Sbjct: 987 ctccactacggcgggtacaacgagatggcggacattctcgtcaacctcacctccttagcc 1046
Query: 535 accgagatggggaggttggtttctgaaggctacgttctcaccgttttggctcccaatgac 594
||||| ||||| |||||||||| |||||||||||||||||||| | |||||||| ||
Sbjct: 1047 accgaaatgggtcggttggtttccgaaggctacgttctcaccgtcctcgctcccaacgat 1106
Query: 595 gaggcgatggcgaagctgacgacggaccagctgagcgaaccgggtgcgccggagcagatc 654
|| || |||||||| ||||||||||| ||| |||| ||||| ||||||||||||||||||
Sbjct: 1107 gaagccatggcgaaactgacgacggagcagttgagtgaacccggtgcgccggagcagatc 1166
Query: 655 at 656
||
Sbjct: 1167 at 1168
>gnl|LJGI|TC74952 similar to UniRef100_A9XTM1 Cluster: Fasciclin-like arabinogalactan
protein 16; n=1; Gossypium hirsutum|Rep: Fasciclin-like
arabinogalactan protein 16 - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), partial (26%)
Length = 518
Score = 178 bits (90), Expect = 3e-44
Identities = 246/298 (82%)
Strand = Plus / Plus
Query: 356 cgatctacgacgcgcttgctccaggaccgtcactcgctccggcgccggcgccaggacctg 415
||||||| || || ||||| || ||||| || || ||||||||||| || || |||||||
Sbjct: 113 cgatctatgaagctcttgccccgggaccctctcttgctccggcgccagctccgggacctg 172
Query: 416 gaggaccacgccaccacttcaacggcgagaaacaggtgaaggatttcatccaaacgctcg 475
| || || | ||||||||||||||||||| ||||||||||||||||||||||| ||
Sbjct: 173 gtggcccccaccaccacttcaacggcgaggcgcaggtgaaggatttcatccaaaccctgc 232
Query: 476 tgcattacggcggttacaacgaaatggcggatattctggtgaatctgacctccctcgcca 535
| || |||||||| |||||||| ||||| || ||||||||||| |||| || | || |
Sbjct: 233 ttcactacggcgggtacaacgagatggctgacattctggtgaacctgatgtcgttggcta 292
Query: 536 ccgagatggggaggttggtttctgaaggctacgttctcaccgttttggctcccaatgacg 595
| || ||||| | ||||| || || || || |||||||| || || ||||| || || |
Sbjct: 293 ctgaaatgggtcgtttggtgtcggagggttatgttctcactgtattagctccgaacgatg 352
Query: 596 aggcgatggcgaagctgacgacggaccagctgagcgaaccgggtgcgccggagcagat 653
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 353 aggccatggcgaagctgacgacggagcagctgagcgaaccgggtgcgccggagcagat 410
>gnl|LJGI|TC58313 similar to UniRef100_A9XTM0 Cluster: Fasciclin-like arabinogalactan
protein 15; n=1; Gossypium hirsutum|Rep: Fasciclin-like
arabinogalactan protein 15 - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), partial (37%)
Length = 1076
Score = 151 bits (76), Expect = 6e-36
Identities = 151/176 (85%)
Strand = Plus / Plus
Query: 481 tacggcggttacaacgaaatggcggatattctggtgaatctgacctccctcgccaccgag 540
|||||||| |||||||| |||||||| ||||| || || || |||||| | ||||||||
Sbjct: 5 tacggcgggtacaacgagatggcggacattctcgtcaacctcacctccttagccaccgaa 64
Query: 541 atggggaggttggtttctgaaggctacgttctcaccgttttggctcccaatgacgaggcg 600
||||| |||||||||| |||||||||||||||||||| | |||||||| || || ||
Sbjct: 65 atgggtcggttggtttccgaaggctacgttctcaccgtcctcgctcccaacgatgaagcc 124
Query: 601 atggcgaagctgacgacggaccagctgagcgaaccgggtgcgccggagcagatcat 656
|||||||| ||||||||||| ||| |||| ||||| ||||||||||||||||||||
Sbjct: 125 atggcgaaactgacgacggagcagttgagtgaacccggtgcgccggagcagatcat 180