Miyakogusa Predicted Gene

Lj1g3v4692840.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4692840.1 tr|G7IKD9|G7IKD9_MEDTR PIF-like protein
OS=Medicago truncatula GN=MTR_2g021280 PE=4
SV=1,34.18,8e-19,Myb_DNA-bind_3,Myb/SANT-like domain;
seg,NULL,gene.Ljchr1_pseudomol_20120830.path1.gene10411.1
         (783 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC68016 similar to UniRef100_A2Q2Z0 Cluster: SAM (And s...   194   6e-49
gnl|LJGI|TC76771 similar to UniRef100_A2Q2Z0 Cluster: SAM (And s...   127   1e-28
gnl|LJGI|TC65932 similar to UniRef100_A2Q2Z0 Cluster: SAM (And s...    70   2e-11

>gnl|LJGI|TC68016 similar to UniRef100_A2Q2Z0 Cluster: SAM (And some other
           nucleotide) binding motif; n=1; Medicago truncatula|Rep:
           SAM (And some other nucleotide) binding motif - Medicago
           truncatula (Barrel medic), partial (98%)
          Length = 1152

 Score =  194 bits (98), Expect = 6e-49
 Identities = 98/98 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   atggacatggttgaaggggtatgctggtatcgcacattggggagctttgttgcaaattca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 325 atggacatggttgaaggggtatgctggtatcgcacattggggagctttgttgcaaattca 266

                                                 
Query: 61  agctgtttctcactagcatccgtggctatgacattctg 98
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 265 agctgtttctcactagcatccgtggctatgacattctg 228


>gnl|LJGI|TC76771 similar to UniRef100_A2Q2Z0 Cluster: SAM (And some other
           nucleotide) binding motif; n=1; Medicago truncatula|Rep:
           SAM (And some other nucleotide) binding motif - Medicago
           truncatula (Barrel medic), partial (75%)
          Length = 1379

 Score =  127 bits (64), Expect = 1e-28
 Identities = 79/84 (94%)
 Strand = Plus / Minus

                                                                       
Query: 15  aggggtatgctggtatcgcacattggggagctttgttgcaaattcaagctgtttctcact 74
           |||||||||||||||   ||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 614 aggggtatgctggtacatcacattggggagcttggttgcaaattcaagctgtttctcact 555

                                   
Query: 75  agcatccgtggctatgacattctg 98
           | ||||||||||||||||||||||
Sbjct: 554 aacatccgtggctatgacattctg 531


>gnl|LJGI|TC65932 similar to UniRef100_A2Q2Z0 Cluster: SAM (And some other
           nucleotide) binding motif; n=1; Medicago truncatula|Rep:
           SAM (And some other nucleotide) binding motif - Medicago
           truncatula (Barrel medic), partial (81%)
          Length = 941

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 51  tgcaaattcaagctgtttctcactagcatccgtggctatgacattct 97
           |||||||||||||||||||||||| |||||||| ||||| |||||||
Sbjct: 236 tgcaaattcaagctgtttctcactggcatccgtagctatcacattct 190