Miyakogusa Predicted Gene
- Lj1g3v4578430.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj1g3v4578430.1 tr|A9DCF4|A9DCF4_9GAMM Ion transporter
OS=Shewanella benthica KT99 GN=KT99_09074 PE=4
SV=1,29.79,1.6,seg,NULL,CUFF.32655.1
(288 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66421 similar to UniRef100_A6RTT4 Cluster: Predicted ... 174 2e-43
gnl|LJGI|CN825005 similar to UniRef100_A0A3A0 Cluster: 40S ribos... 84 5e-16
gnl|LJGI|GO010214 homologue to UniRef100_Q1S9I9 Cluster: Probabl... 54 5e-07
gnl|LJGI|TC71116 homologue to UniRef100_Q1S9I9 Cluster: Probable... 54 5e-07
gnl|LJGI|TC65926 homologue to UniRef100_A2IBL2 Cluster: Histone ... 54 5e-07
>gnl|LJGI|TC66421 similar to UniRef100_A6RTT4 Cluster: Predicted protein; n=1;
Botryotinia fuckeliana B05.10|Rep: Predicted protein -
Botryotinia fuckeliana (strain B05.10) (Noble rot
fungus) (Botrytiscinerea), partial (5%)
Length = 785
Score = 174 bits (88), Expect = 2e-43
Identities = 88/88 (100%)
Strand = Plus / Plus
Query: 1 atgaatgggttgatgatgattctgatctggatctcggtcatgtgggtcaaaggttcaatg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 262 atgaatgggttgatgatgattctgatctggatctcggtcatgtgggtcaaaggttcaatg 321
Query: 61 gatccggatctgggttcaatgattcaga 88
||||||||||||||||||||||||||||
Sbjct: 322 gatccggatctgggttcaatgattcaga 349
Score = 165 bits (83), Expect = 2e-40
Identities = 83/83 (100%)
Strand = Plus / Plus
Query: 206 tgccagagagttggccaagcctgccgtctccgaggggaccaagaagttcacaagttcttg 265
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 467 tgccagagagttggccaagcctgccgtctccgaggggaccaagaagttcacaagttcttg 526
Query: 266 aactaacaagaacaatcttgtag 288
|||||||||||||||||||||||
Sbjct: 527 aactaacaagaacaatcttgtag 549
Score = 52.0 bits (26), Expect = 2e-06
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 1 atgaatgggttgatgatgattctgatctgg 30
||||||||||||||||||||| ||||||||
Sbjct: 193 atgaatgggttgatgatgattttgatctgg 222
>gnl|LJGI|CN825005 similar to UniRef100_A0A3A0 Cluster: 40S ribosomal protein S24;
n=1; Artemisia annua|Rep: 40S ribosomal protein S24 -
Artemisia annua (Sweet wormwood), partial (21%)
Length = 665
Score = 83.8 bits (42), Expect = 5e-16
Identities = 73/82 (89%), Gaps = 1/82 (1%)
Strand = Plus / Plus
Query: 1 atgaatgggttgatgatgattctgatctggatctcggtcatgtgggtcaa-aggttcaat 59
|||||||||||||||||| || |||| |||||| ||||||||||||| |||||||||
Sbjct: 501 atgaatgggttgatgatggtttcaatcttaatctcgctcatgtgggtcaagaggttcaat 560
Query: 60 ggatccggatctgggttcaatg 81
||||| ||||||||||||||||
Sbjct: 561 ggatctggatctgggttcaatg 582
>gnl|LJGI|GO010214 homologue to UniRef100_Q1S9I9 Cluster: Probable histone H2B.1; n=1;
Medicago truncatula|Rep: Probable histone H2B.1 -
Medicago truncatula (Barrel medic), partial (74%)
Length = 612
Score = 54.0 bits (27), Expect = 5e-07
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 248 gaagttcacaagttcttgaactaacaa 274
|||||||||||||||||||||||||||
Sbjct: 399 gaagttcacaagttcttgaactaacaa 425
>gnl|LJGI|TC71116 homologue to UniRef100_Q1S9I9 Cluster: Probable histone H2B.1; n=1;
Medicago truncatula|Rep: Probable histone H2B.1 -
Medicago truncatula (Barrel medic), complete
Length = 792
Score = 54.0 bits (27), Expect = 5e-07
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 248 gaagttcacaagttcttgaactaacaa 274
|||||||||||||||||||||||||||
Sbjct: 529 gaagttcacaagttcttgaactaacaa 555
>gnl|LJGI|TC65926 homologue to UniRef100_A2IBL2 Cluster: Histone H2B; n=1; Nicotiana
benthamiana|Rep: Histone H2B - Nicotiana benthamiana,
partial (80%)
Length = 634
Score = 54.0 bits (27), Expect = 5e-07
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 248 gaagttcacaagttcttgaactaacaa 274
|||||||||||||||||||||||||||
Sbjct: 422 gaagttcacaagttcttgaactaacaa 448